«Εάν δεν είσαι ικανός να εκνευρίζεις κανέναν με τα γραπτά σου, τότε να εγκαταλείψεις το επάγγελμα»

ΩΡΑ ΕΛΛΑΔΟΣ

Επικοινωνία εδώ

Για σχόλια, καταγγελίες και επικοινωνία στο

ΚΑΤΗΓΟΡΙΕΣ ΘΕΜΑΤΩΝ

ΒΟΥΛΗ

Ενημέρωση των αναγνωστών.

Προσοχή στις απάτες, η ΑΡΧΑΙΑ ΙΘΩΜΗ και ο ΚΩΝΣΤΑΝΤΙΝΟΣ ΚΑΝΕΛΛΟΠΟΥΛΟΣ δεν φέρει καμία ευθύνη για οποιαδήποτε συναλλαγή με κάρτες η άλλον τρόπω και άλλα στον όνομά της, Ή στο όνομα του κυρίου Γ. Θ, Χατζηθεοδωρου. Δεν έχουμε καμία χρηματική απαίτηση από τους αναγνώστες με οποιοδήποτε τρόπο.
Αγαπητοί αναγνώστες η ανθελληνική και βρόμικη google στην κορυφή της ιστοσελίδας όταν μπείτε, αναφέρει μη ασφαλής την ιστοσελίδα, ξέρετε γιατί;;; Διότι δεν της πληρώνω νταβατζιλίκι, κάθε φορά ανακαλύπτει νέα κόλπα να απειλή. Η ΑΡΧΑΙΑ ΙΘΩΜΗ σας εγγυάται, ότι δεν διατρέχετε κανένα κίνδυνο, διότι πληρώνω με στερήσεις το ισχυρότερο αντιβάριους της Eugene Kaspersky, όπως δηλώνει και ο Πρόεδρος και Διευθύνων Σύμβουλος της Kaspersky Lab "Πιστεύουμε ότι όλοι μας δικαιούμαστε να είμαστε ασφαλείς στο διαδίκτυο. Eugene Kaspersky

Ανακοίνωση

Τη λειτουργία μίας νέας γραμμής που αφορά τον κορωνοϊό ανακοίνωσε ο Εθνικός Οργανισμός Δημόσιας Υγείας. Ο Εθνικός Οργανισμός Δημόσιας Υγείας ανακοινώνει, ότι από σήμερα 07.03.2020 λειτουργεί η τηλεφωνική γραμμή 1135, η οποία επί 24ώρου βάσεως θα παρέχει πληροφορίες σχετικά με τον νέο κοροναϊό.

Πού μπορεί να απευθυνθεί μια γυναίκα που πέφτει θύμα ενδοοικογενειακής βίας;

«Μένουμε σπίτι θα πρέπει να σημαίνει πως μένουμε ασφαλείς και προστατευμένες. Για πολλές γυναίκες, όμως, σημαίνει το ακριβώς αντίθετο. Εάν υφίστασαι βία στο σπίτι, δεν είσαι μόνη. Είμαστε εδώ για σένα. Μένουμε σπίτι δεν σημαίνει ότι υπομένουμε τη βία. Μένουμε σπίτι δεν σημαίνει μένουμε σιωπηλές. Τηλεφώνησε στη γραμμή SOS 15900. Οι ψυχολόγοι και οι κοινωνικοί λειτουργοί της γραμμής θα είναι εκεί για σε ακούσουν και να σε συμβουλέψουν. Δεν μπορείς να μιλήσεις; Στείλε email στο sos15900@isotita.gr ή σε οποιοδήποτε από τα Συμβουλευτικά Κέντρα ” λέει σε ένα βίντεο που ανέβασε στο Instagram της η Ελεονώρα Μελέτη.

Προς ενημέρωση στους αναγνώστες. 4/8/2020

Η ΑΡΧΑΙΑ ΙΘΩΜΗ δεν ανάγκασε ποτέ κανένα να κάνει κάτι με παραπλανητικές μεθόδους, αλλά ούτε με οποιοδήποτε τρόπο. Ο γράφων είμαι ένας ανήσυχος ερευνητής της αλήθειας. Και αυτό το κάνω με νόμιμο τρόπο. Τι σημαίνει αυτό; ότι έχω μαζέψει πληροφορίες επιστημονικές και τις παρουσιάζω, ή αυτούσιες, ή σε άρθρο μου που έχει σχέση με αυτές τις πληροφορίες! Ποτέ δεν θεώρησα τους αναγνώστες μου ηλίθιους ή βλάκες και ότι μπορώ να τους επιβάλω την γνώμη μου. Αυτοί που λένε ότι κάποια ιστολόγια παρασέρνουν τον κόσμο να μην πειθαρχεί… Για ποιο κόσμο εννοούν;;; Δηλαδή εκ προοιμίου θεωρούν τον κόσμο βλάκα, ηλίθιο και θέλουν να τον προστατέψουν;;; Ο νόμος αυτό το λέει για τους ανώριμους ανήλικους. Για τους ενήλικους λέει ότι είναι υπεύθυνοι για ότι πράττουν. Στον ανήλικο χρειάζεται ένας διπλωματούχος ιδικός για να τον δασκαλέψει, καθηγητής, δάσκαλος. Στους ενήλικες δεν υπάρχει περιορισμός. Ποιος λέει και ποιος ακούει, διότι ο καθένας ενήλικος είναι υπεύθυνος και προς τους άλλους και προς τον εαυτό του.

Δείτε για την απάτη Κορονοϊος όπως μα δείχνει το βίντεο που ανέβασα λίγο πιο πριν. Αλλα και όσα έχω γράψει μέχρι σήμερα από σκόρπιες πληροφορίες.

ΦΑΟΥΤΣΙ (4)

Οι  κωδικοί για τις  πατέντες για τον κορονοϊο

Κορωνοϊός απομονωμένος από ανθρώπους

Αφηρημένη

Αποκαλύπτεται εδώ ένας πρόσφατα απομονωμένος ανθρώπινος κορωνοϊός (SARS-CoV), ο αιτιολογικός παράγοντας του σοβαρού οξέος αναπνευστικού συνδρόμου (SARS). Παρέχονται επίσης η αλληλουχία νουκλεϊκών οξέων του γονιδιώματος SARS-CoV και οι αλληλουχίες αμινοξέων των ανοικτών πλαισίων ανάγνωσης SARS-CoV, καθώς και μέθοδοι χρήσης αυτών των μορίων για την ανίχνευση ενός SARS-CoV και τον εντοπισμό μολύνσεων με αυτό. Παρέχονται επίσης ανοσοδιεγερτικές συνθέσεις, μαζί με μεθόδους χρήσης τους.

Εικόνες ( 7 )

Για τις εικόνες θα πάτε στο σύνδεσμο, αν και δεν μας ενδιαφέρουν.

Ταξινόμηση

 C07K14/005 Πεπτίδια που έχουν περισσότερα από 20 αμινοξέα. Gastrins; Σωματοστατίνες; Μελανοτροπίνες; Παράγωγα αυτών από ιούς

Δείτε 6 ακόμη ταξινομήσεις

US7776521B1

Ηνωμένες Πολιτείες

 Λήψη PDF  Βρείτε την Προηγούμενη Τέχνη  Παρόμοιος

Εφευρέτης

Paul A. Route

Larry J. Anderson

William J. Bellini

Michael D. Bowen

Η Καρτέλ Μπερνς

Ρέιμοντ Καμπανιόλι

Τσι Τσεν

James A. Comer

Byron T. Cook

Shannon L. Emery

Dean D. Erdman

Cynthia S. Goldsmith

Jeanette Guarner

Charles D. Humphrey

Joseph P. Icenogle

Thomas G. Ksiazek

Richard F. Meyer

Stephan S. Monroe

Γουίλιαμ Άλαν Νιξ

  1. Steven Colonel

Christopher D. Paddock

Teresa CT Peret

Pierre E. Rollin

Mark A. Pallansch

Άντονι Σάντσες

Wun-Ju Shieh

Suxiang Tong

Σερίφ Ρ. Ζάκη

Τρέχων Ανάδοχος

Κέντρα Ελέγχου και Πρόληψης Νοσημάτων CDC

Παγκόσμιες εφαρμογές

2004  ΜΑΣ 2007  ΜΑΣ

Εφαρμογή US11/748.359 συμβάντα

2003-04-25

Priority to US46592703P

2004-04-12

Priority to US10/822,904

2007-05-14

Η αίτηση υποβλήθηκε από το Κέντρο Ελέγχου και Πρόληψης Νοσημάτων CDC

2007-05-14

Priority to US11/748,359

2007-06-28

Εκχωρήθηκε στην ΚΥΒΕΡΝΗΣΗ ΤΩΝ ΗΝΩΜΕΝΩΝ ΚΡΑΤΩΝ ΤΗΣ ΑΜΕΡΙΚΗΣ ΟΠΩΣ ΕΚΠΡΟΣΩΠΕΙ Ο ΓΡΑΜΜΑΤΕΑΣ ΤΟΥ ΤΜΗΜΑΤΟΣ ΥΓΕΙΑΣ ΚΑΙ ΑΝΘΡΩΠΙΝΩΝ ΥΠΗΡΕΣΙΩΝ, ΚΕΝΤΡΑ ΕΛΕΓΧΟΥ ΚΑΙ ΠΡΟΛΗΗΣ ΑΣΘΕΝΕΙΩΝ

2010-08-17

Η αίτηση εγκρίθηκε

2010-08-17

Δημοσίευση του US7776521B1

Κατάσταση

Έληξε – Σχετικά με τα τέλη

2024-07-17

Προσαρμοσμένη λήξη

Πληροφορίες

Παραπομπές διπλωμάτων ευρεσιτεχνίας (3)

Παραπομπές χωρίς δίπλωμα ευρεσιτεχνίας (22)

Παρατίθεται από (9)

Νομικά γεγονότα

Παρόμοια έγγραφα

Προτεραιότητα και σχετικές εφαρμογές

εξωτερικοί σύνδεσμοι

USPTO

Ανάθεση USPTO

Espacenet

Παγκόσμιος φάκελος

Συζητώ

Περιγραφή

ΑΙΤΗΣΗ ΠΡΟΤΕΡΑΙΟΤΗΤΑΣ

Πρόκειται για ένα τμήμα εκκρεμούσας αίτησης διπλώματος ευρεσιτεχνίας ΗΠΑ Ser. Αρ. 10/822,904, που κατατέθηκε στις 12 Απριλίου 2004 και εκδόθηκε ως Δίπλωμα Ευρεσιτεχνίας ΗΠΑ. Αρ. 7,220,852 στις 22 Μαΐου 2007, η οποία με τη σειρά της διεκδικεί το όφελος της προσωρινής αίτησης διπλώματος ευρεσιτεχνίας ΗΠΑ αρ.

ΔΗΛΩΣΗ ΚΥΒΕΡΝΗΤΙΚΗΣ ΣΤΗΡΙΞΗΣ

Αυτή η εφεύρεση έγινε από τα Κέντρα Ελέγχου και Πρόληψης Νοσημάτων, μια υπηρεσία της κυβέρνησης των Ηνωμένων Πολιτειών. Επομένως, η κυβέρνηση των ΗΠΑ έχει ορισμένα δικαιώματα σε αυτήν την εφεύρεση.

ΠΕΔΙΟ ΤΗΣ ΑΠΟΚΑΛΥΗΣ

Αυτή η εφεύρεση σχετίζεται με έναν νέο απομονωμένο ανθρώπινο κορωνοϊό. Πιο συγκεκριμένα, σχετίζεται με ένα απομονωμένο γονιδίωμα κορωνοϊού, απομονωμένες πρωτεΐνες κορονοϊού και απομονωμένα μόρια νουκλεϊκού οξέος που κωδικοποιούν το ίδιο. Η αποκάλυψη σχετίζεται περαιτέρω με μεθόδους ανίχνευσης κορονοϊού που σχετίζεται με σοβαρό οξύ αναπνευστικό σύνδρομο και συνθέσεις που περιλαμβάνουν ανοσογονικές ενώσεις κορωνοϊού.

ΙΣΤΟΡΙΚΟ

Οι κορονοϊοί (τάξη Nidovirales, οικογένεια Coronaviridae, γένος Coronavirus) είναι μια ποικίλη ομάδα μεγάλων, τυλιγμένων, θετικών κλώνων ιών RNA που προκαλούν αναπνευστικές και εντερικές ασθένειες σε ανθρώπους και άλλα ζώα. Σε περίπου 30.000 νουκλεοτίδια (nt), το γονιδίωμά τους είναι το μεγαλύτερο που βρίσκεται σε οποιονδήποτε από τους ιούς RNA. Οι κορονοϊοί είναι σφαιρικοί, με διάμετρο 100-160 nm με περίπλοκες προεξοχές επιφάνειας 20-40 nm που περιβάλλουν την περιφέρεια. Οι κορονοϊοί μοιράζονται κοινές δομικές πρωτεΐνες που περιλαμβάνουν πρωτεΐνη ακίδων (S), πρωτεΐνη μεμβράνης (Μ), πρωτεΐνη περιβλήματος (Ε) και, σε ένα υποσύνολο κορωνοϊών, μια πρωτεΐνη αιμαγλουτινίνης-εστεράσης (HE). Η πρωτεΐνη S, μια γλυκοπρωτεΐνη που προεξέχει από τη μεμβράνη του ιού, εμπλέκεται στη σύνδεση των υποδοχέων των κυττάρων ξενιστών και αποτελεί στόχο εξουδετέρωσης αντισωμάτων. Οι πρωτεΐνες Ε και Μ εμπλέκονται στο σχηματισμό και την απελευθέρωση του ιοσωματίου από το κύτταρο ξενιστή. Τα σωματίδια του κορωνοϊού βρίσκονται μέσα στις στέρνες του τραχύ ενδοπλασματικού δικτύου και σε κυστίδια μολυσμένων κυττάρων ξενιστών όπου συγκεντρώνονται ιοσωματίδια. Το γονιδίωμα του κορωνοϊού αποτελείται από δύο ανοιχτά πλαίσια ανάγνωσης (ORF1a και ORF1b) που δίνουν μια πολυμεράση RNA και ένα ένθετο σύνολο υπογονιδιωματικών mRNA που κωδικοποιούν δομικές και μη δομικές πρωτεΐνες, συμπεριλαμβανομένων των πρωτεϊνών S, E, M και νουκλεοκαψιδίου (Ν). Το γένοςΟ κορονοϊός περιλαμβάνει τουλάχιστον 13 είδη τα οποία έχουν υποδιαιρεθεί σε τουλάχιστον τρεις ομάδες (ομάδες Ι, ΙΙ και ΙΙΙ) με βάση τις ορολογικές και γενετικές ιδιότητες (deVries et al., Sem. Virol. 8: 33-47, 1997; Fields et αϊ eds.. Fields Virology, 3η έκδοση, Raven Press, Philadelphia, 1323-1341, 1996?. Mahey και Collier eds Μικροβιολογία και Λοιμώξεις Μικροβιακή , τόμος 1 Virology, 9 th edition, Oxford University Press, 463-479, 1998 ).

Οι τρεις γνωστές ομάδες του κοροναϊού σχετίζονται με μια ποικιλία ασθενειών ανθρώπων και κατοικίδιων ζώων (για παράδειγμα, βοοειδή, χοίρους, γάτες, σκύλους, τρωκτικά και πτηνά), συμπεριλαμβανομένης της γαστρεντερίτιδας και των παθήσεων του άνω και κάτω αναπνευστικού συστήματος. Οι γνωστοί κορωνοϊοί περιλαμβάνουν τον ανθρώπινο κορονοϊό 229E (HCoV-229E), τον κορωνοϊό σκύλου (CCoV), τον ιό μολυσματικής περιτονίτιδας αιλουροειδών (FIPV), τον ιό μεταδοτικής γαστρεντερίτιδας των χοίρων (TGEV), τον ιό της επιδημικής διάρροιας των χοίρων (PEDV), τον ανθρώπινο κορονοϊό OC43 (HCoV-OC43) , κοροναϊός βοοειδών (BCoV), ιός αιμοσυγκόλλησης εγκεφαλομυελίτιδας χοίρου (HEV), ιός σιαλοδακρυοαδενίτιδας αρουραίου (SDAV), ιός ηπατίτιδας ποντικού (MHV), κορονοϊός γαλοπούλας (TCoV) και ιός μολυσματικής βρογχίτιδας των πτηνών (IBV-Avian) (Fields et al. εκδ. Πεδία Ιολογία,3η έκδοση, Raven Press, Φιλαδέλφεια, 1323-1341, 1996; Εκδόσεις Mahey και Collier. Μικροβιολογία και μικροβιακή Λοιμώξεις , τόμος 1 Ιολογίας, 9 ος έκδοση, Oxford University Press, 463 – 479, 1998).

Οι λοιμώξεις από κορονοϊό είναι γενικά ειδικές για τον ξενιστή όσον αφορά τη μολυσματικότητα και τα κλινικά συμπτώματα. Οι κορονοϊοί επιδεικνύουν περαιτέρω έντονο τροπισμό ιστών. μόλυνση στο λανθασμένο είδος ξενιστή ή τύπο ιστού μπορεί να οδηγήσει σε αποβολή, λοίμωξη, παραγωγή μεταλλαγμένου ιού και μεταβαλλόμενη μολυσματικότητα. Οι κορονοϊοί γενικά δεν αναπτύσσονται καλά σε κυτταρική καλλιέργεια και ζωικά μοντέλα για τον ανθρώπινο κορονοϊόλείπει η μόλυνση. Επομένως, λίγα είναι γνωστά για αυτά (Fields et al. Eds. Fields Virology, 3rd edition, Raven Press, Philadelphia, 1323-1341, 1996). Οι γνωστοί ανθρώπινοι κοροναϊοί είναι ιδιαίτερα επιζήμιοι στην κυτταρική καλλιέργεια, προτιμώντας επιλεγμένες κυτταρικές σειρές, καλλιέργεια οργάνων ή θηλάζοντα ποντίκια για πολλαπλασιασμό. Οι κορονοϊοί που αναπτύσσονται σε κυτταρική καλλιέργεια εμφανίζουν ποικίλους βαθμούς μολυσματικότητας και/ή κυτταροπαθητικής επίδρασης (CPE) ανάλογα με τον τύπο του κυττάρου ξενιστή και τις συνθήκες καλλιέργειας. Ο μόνος κοροναϊός ανθρώπου ή ζώου που έχει αποδειχθεί ότι αναπτύσσεται στα κύτταρα Vero E6 είναι το PEDV και απαιτεί την προσθήκη θρυψίνης στο μέσο καλλιέργειας για ανάπτυξη στα κύτταρα Vero E6. Επιπλέον, το PEDV προσαρμοσμένο στην κυτταρική καλλιέργεια Vero Ε6 καταλήγει σε ένα εντυπωσιακά διαφορετικό CPE, με κυτταροπλασματικά κενοτόπια και σχηματισμό μεγάλων συγκυτίων (Hofmann and Wyler, J. Clin. Micro.26: 2235-39, 1988; Kusanagi et al., J. Vet. Με. Sci. 554: 313-18, 1991).

Ο κορωνοϊός δεν ήταν προηγουμένως γνωστό ότι προκαλεί σοβαρή ασθένεια στους ανθρώπους, αλλά έχει αναγνωριστεί ως η κύρια αιτία ασθένειας του ανώτερου αναπνευστικού, συμπεριλαμβανομένου του κοινού κρυολογήματος. Οι επαναλαμβανόμενες μολύνσεις στον άνθρωπο είναι συχνές εντός και πέρα ​​από τον ορότυπο, υποδηλώνοντας ότι η ανοσολογική απάντηση στη μόλυνση από τον κορονοϊό στους ανθρώπους είναι είτε ατελής είτε βραχύβια. Η μόλυνση από κορωνοϊό σε ζώα μπορεί να προκαλέσει σοβαρή εντερική ή αναπνευστική νόσο. Ο εμβολιασμός έχει χρησιμοποιηθεί με επιτυχία για την πρόληψη και τον έλεγχο ορισμένων λοιμώξεων από κορωνοϊό σε ζώα. Η ικανότητα των ειδικών για ζώα κορωνοϊών να προκαλούν σοβαρές ασθένειες αυξάνει την πιθανότητα ο κοροναϊός να προκαλέσει και πιο σοβαρή ασθένεια στους ανθρώπους (Fields et al. Eds. Fields Virology, 3rd edition, Raven Press, Philadelphia, 1323-1341, 1996 · Mahey and Εκδ. Collier.Μικροβιολογία και μικροβιακή Λοιμώξεις , τόμος 1 Ιολογίας, 9 ος έκδοση, Oxford University Press, 463 – 479, 1998).

Στα τέλη του 2002, αναφέρθηκαν περιπτώσεις απειλητικών για τη ζωή αναπνευστικών ασθενειών χωρίς αναγνωρίσιμη αιτιολογία από την επαρχία Γκουανγκντόνγκ της Κίνας, ακολουθούμενες από αναφορές από το Βιετνάμ, τον Καναδά και το Χονγκ Κονγκ για σοβαρές εμπύρετες αναπνευστικές ασθένειες που εξαπλώθηκαν στα μέλη του νοικοκυριού και στους εργαζόμενους στην υγειονομική περίθαλψη. Το σύνδρομο ονομάστηκε «σοβαρό οξύ αναπνευστικό σύνδρομο» (SARS) τον Φεβρουάριο του 2003 από τα Κέντρα Ελέγχου και Πρόληψης Νοσημάτων ( MMWR, 52: 241-48, 2003).

Οι προσπάθειες του παρελθόντος για την ανάπτυξη ταχείας διάγνωσης και εμβολίων για τη μόλυνση από τον κορωνοϊό στους ανθρώπους παρεμποδίστηκαν από την έλλειψη κατάλληλων ερευνητικών μοντέλων και τη μέτρια πορεία της νόσου στους ανθρώπους. Επομένως, υπάρχει ανάγκη για ταχεία διαγνωστικά τεστ και εμβόλια.

ΠΕΡΙΛΗΗ ΤΗΣ ΑΠΟΚΑΛΥΗΣ

Ένας πρόσφατα απομονωμένος ανθρώπινος κορωνοϊός έχει αναγνωριστεί ως ο αιτιολογικός παράγοντας του SARS και ονομάζεται SARS-CoV. Η αλληλουχία νουκλεϊκών οξέων του γονιδιώματος SARS-CoV και οι αλληλουχίες αμινοξέων των ανοικτών πλαισίων ανάγνωσης SARS-CoV παρέχονται εδώ.

Αυτή η αποκάλυψη παρέχει μεθόδους και συνθέσεις χρήσιμες για την ανίχνευση της παρουσίας νουκλεϊκού οξέος SARS-CoV σε δείγμα και/ή διάγνωσης μόλυνσης SARS-CoV σε άτομο. Παρέχονται επίσης μέθοδοι και συνθέσεις χρήσιμες για την ανίχνευση της παρουσίας αντιγόνου ή αντισώματος SARS-CoV σε δείγμα και/ή διάγνωσης λοίμωξης SARS-CoV σε άτομο.

Τα προηγούμενα και άλλα χαρακτηριστικά και πλεονεκτήματα θα γίνουν πιο εμφανή από την ακόλουθη λεπτομερή περιγραφή πολλών υλοποιήσεων, η οποία προχωρά με αναφορά στα συνοδευτικά σχήματα.

ΣΥΝΤΟΜΗ ΠΕΡΙΓΡΑΦΗ ΤΩΝ ΕΙΚΟΝΩΝ

ΣΧΕΔΙΑ 1Α-Β είναι φωτομικρογραφίες που απεικονίζουν τυπικές πρώιμες κυτταροπαθητικές επιδράσεις που παρατηρήθηκαν με απομονωμένα κορωνοϊά και ορό από ασθενείς με SARS. ΣΥΚΟ. 1Α είναι μια φωτομικρογραφία κυττάρων Vero Ε6 που εμβολιάστηκαν με στοματοφαρυγγικό δείγμα από ασθενή με SARS (x40). ΣΥΚΟ. 1Β είναι μια φωτομικρογραφία μολυσμένων κυττάρων Vero E6 που αντιδρούν με τον ορό ενός αναρρώσαντος ασθενούς SARS σε δοκιμασία έμμεσου φθορισμού αντισώματος (IFA) (x400).

ΣΧΕΔΙΑ 2Α-Β είναι ηλεκτρονικές μικρογραφίες που απεικονίζουν υπερδομικά χαρακτηριστικά του κορονοϊού που σχετίζεται με το SARS (SARS-CoV). ΣΥΚΟ. 2Αείναι μια ηλεκτρονική-μικροσκοπική όψη λεπτού τμήματος ιικών νουκλεοκαψιδίων ευθυγραμμισμένων κατά μήκος της μεμβράνης του τραχύ ενδοπλασματικού δικτύου (βέλος) καθώς τα σωματίδια μπουμπούνουν στις στέρνες. Τα περιτυλιγμένα virions έχουν επιφανειακές προεξοχές (κεφαλή βέλους) και ένα κέντρο που διαπερνά ηλεκτρόνια. Ακριβώς κάτω από το φάκελο του ιού βρίσκεται ένας χαρακτηριστικός δακτύλιος που σχηματίζεται από το ελικοειδές νουκλεοκαψίδιο, που συχνά παρατηρείται σε διατομή.ΣΥΚΟ. 2Βείναι μια αρνητική κηλίδα (βολφραμική μεθυλαμίνη) ηλεκτρονική μικρογραφία που δείχνει σωματίδιο κοροναϊού διεισδυμένο σε λεκέδες με την τυπική εσωτερική ελικοειδή δομή που μοιάζει με νουκλεοκαψίδιο και προεξοχές επιφάνειας σε σχήμα κορμού που περιβάλλουν την περιφέρεια του σωματιδίου. Μπάρες: 100 nm.

ΣΥΚΟ. 3είναι ένα εκτιμώμενο μέγιστο δέντρο παρρησίας που απεικονίζει πιθανές φυλογενετικές σχέσεις μεταξύ του SARS-CoV και άλλων κορωνοϊών ανθρώπων και ζώων. Οι φυλογενετικές σχέσεις βασίζονται στην ευθυγράμμιση αλληλουχίας 405 νουκλεοτιδίων του γονιδίου πολυμεράσης του κορονοϊού ORF1b (νουκλεϊκό οξύ 15,173 έως 15,578 της SEQ ID ΝΟ: 1). Οι τρεις κύριες αντιγονικές ομάδες του κορωνοϊού (I, II και III), που αντιπροσωπεύονται από τους HCoV-229E, CCoV, FIPV, TGEV, PEDV, HCoV-OC43, BCoV, HEV, SDAV, MHV, TCoV και IBV-Avian, εμφανίζονται σκιασμένες Το Οι τιμές του Bootstrap (100 επαναλήψεις) που λαμβάνονται από ένα δέντρο συναίνεσης κανόνα πλειοψηφίας 50% απεικονίζονται στους κύριους εσωτερικούς κλάδους του φυλογράμματος. Το μήκος των κλάδων είναι ανάλογο με τις διαφορές νουκλεοτιδίων.

ΣΥΚΟ. 4είναι μια εικονογραφική αναπαράσταση του γείτονα που ενώνει δέντρα και απεικονίζει υποθετικές φυλογενετικές σχέσεις μεταξύ του SARS-CoV και άλλων κορωνοϊών ανθρώπων και ζώων. Οι αλληλουχίες αμινοξέων των υποδεικνυόμενων πρωτεϊνών SARS-CoV συγκρίθηκαν με εκείνες από ιούς αναφοράς που αντιπροσωπεύουν κάθε είδος στις τρεις ομάδες κοροναϊών για τις οποίες ήταν διαθέσιμες πλήρεις πληροφορίες γονιδιωματικής αλληλουχίας [ομάδα 1: HCoV-229E (AF304460). PEDV (AF353511); TGEV (AJ271965); ομάδα 2: BCoV (AF220295); MHV (AF201929); ομάδα 3: ιός μολυσματικής βρογχίτιδας (M95169)]. Αλληλουχίες για αντιπροσωπευτικά στελέχη άλλων ειδών κορωνοϊού, για τα οποία υπήρχαν πληροφορίες μερικής αλληλουχίας, συμπεριλήφθηκαν για μερικές από τις συγκρίσεις δομικών πρωτεϊνών [ομάδα 1: CCoV (D13096). FCoV (AY204704); αναπνευστικός κορωνοϊός χοίρου (Z24675) · ομάδα 2: HCoV-OC43 (M76373, L14643, M93390); HEV (AY078417); κορωνοϊός αρουραίου (AF207551)]. Οι ευθυγραμμίσεις αλληλουχίας και τα δέντρα που ενώνονται με γείτονες δημιουργήθηκαν χρησιμοποιώντας το Clustalx 1.83 με τη μήτρα σύγκρισης πρωτεϊνών Gonnet. Τα δέντρα που προέκυψαν προσαρμόστηκαν για την τελική απόδοση χρησιμοποιώντας treetool 2.0.1.

ΣΧΕΔΙΑ 5Α-Γ είναι φωτομικρογραφίες που απεικονίζουν διάχυτη κυψελιδική βλάβη σε ασθενή με SARS (ΣΧΕΔΙΑ 5Α-Β), και ανοσοϊστοχημική χρώση κυττάρων Vero E6 μολυσμένων με SARS-CoV (ΣΥΚΟ. 5C). ΣΥΚΟ. 5Αείναι μια φωτομικρογραφία πνευμονικού ιστού από ασθενή με SARS (x50). Υπάρχουν διάχυτες κυψελιδικές βλάβες, άφθονα αφρώδη μακροφάγα και πολυπύρηνα συγκυτιακά κύτταρα. χρησιμοποιήθηκε λεκές αιματοξυλίνης και ηωσίνης.ΣΥΚΟ. 5Βείναι φωτομικρογραφία υψηλότερης μεγέθυνσης του πνευμονικού ιστού από τον ίδιο ασθενή με SARS (x250). Τα συγκυτιακά κύτταρα δεν εμφανίζουν εμφανή ιικά εγκλείσματα.ΣΥΚΟ. 5Cείναι μια φωτομικρογραφία ανοσοϊστοχημικά βαμμένων κυττάρων μολυσμένων με SARS-CoV (x250). Μεμβρανώδης και κυτταροπλασματική ανοσοχρώση μεμονωμένων και συγκυτικών κυττάρων Vero E6 επιτεύχθηκε χρησιμοποιώντας ασκιτικό υγρό αιλουροειδούς αντι-FIPV-1. Χρησιμοποιήθηκε ανοσοαλκαλική φωσφατάση με κόκκινο υπόστρωμα γρήγορης ναφθόλης και αντίθετη κηλίδα αιματοξυλίνης.

ΣΧΕΔΙΑ 6Α-Β είναι ηλεκτρονικές μικρογραφίες που απεικονίζουν τα υπερδομικά χαρακτηριστικά ενός κυττάρου μολυσμένου με κορονοϊό σε βρογχοκυψελιδική πλύση (BAL) από ασθενή με SARS. ΣΥΚΟ. 6Αείναι μια ηλεκτρονική μικρογραφία κυττάρου μολυσμένου από κορονοϊό. Υπάρχουν πολλά ενδοκυτταρικά και εξωκυτταρικά σωματίδια. τα virions υποδεικνύονται από τις βελόνες βέλους.ΣΥΚΟ. 6Β είναι μια ηλεκτρονική μικρογραφία υψηλότερης μεγέθυνσης της περιοχής που φαίνεται στο βέλος προς τα μέσα ΣΥΚΟ. 6Α(περιστρέφεται δεξιόστροφα περίπου) 90 °. Μπάρες:ΣΥΚΟ. 6Α, 1 μm; ΣΥΚΟ. 6Β, 100 nm

ΣΧΕΔΙΑ 7Α-Γ απεικονίζουν την οργάνωση του γονιδιώματος SARS-CoV. ΣΥΚΟ. 7Αείναι ένα διάγραμμα της συνολικής οργάνωσης του γονιδιωματικού RNA του 29,727-nt SARS-CoV. Η ακολουθία 72-nt οδηγού αντιπροσωπεύεται ως ένα μικρό ορθογώνιο στο αριστερότερο άκρο. Τα ORFs1a και 1b, που κωδικοποιούν τις μη δομικές πολυπρωτεΐνες, και αυτά τα ORF που κωδικοποιούν τις δομικές πρωτεΐνες S, E, M και N, υποδεικνύονται. Η κάθετη θέση των κουτιών υποδεικνύει τη φάση του πλαισίου ανάγνωσης (φάση 1 για πρωτεΐνες πάνω από τη γραμμή, φάση δεύτερη για πρωτεΐνες στη γραμμή και φάση τρεις για πρωτεΐνες κάτω από τη γραμμή).ΣΥΚΟ. 7Βείναι μια διευρυμένη άποψη της δομικής περιοχής που κωδικοποιεί πρωτεΐνη και προβλέπονται μεταγραφές mRNA. Υποδεικνύονται γνωστές δομικές περιοχές κωδικοποίησης πρωτεΐνης (σκούρα γκρι κουτιά) και περιοχές και πλαίσια ανάγνωσης για πιθανά προϊόντα X1-X5 (ανοιχτό γκρι κουτιά). Τα μήκη και οι θέσεις χαρτών των 3′-τερματικών mRNA που εκφράζονται από το SARS-CoV υποδεικνύονται, όπως προβλέπεται από την αναγνώριση των διατηρημένων μεταγραφικών ρυθμιστικών αλληλουχιών.ΣΥΚΟ. 7Cείναι μια ψηφιοποιημένη εικόνα νάιλον μεμβράνης που δείχνει ανάλυση στυπώματος Northern των mRNAs SARS-CoV. Poly (A)+ RNA από μολυσμένα κύτταρα Vero E6 διαχωρίστηκε σε πηκτή φορμαλδεhyδης-αγαρόζης, μεταφέρθηκε σε νάιλον μεμβράνη και υβριδοποιήθηκε με ριβοπροσκόπιο επισημασμένο με διγοξιγενίνη επικαλύπτοντας την 3′-αμετάφραστη περιοχή. Τα σήματα οπτικοποιήθηκαν με χημειοφωταύγεια. Τα μεγέθη των mRNA των SARS-CoV υπολογίστηκαν με παρέκταση από μια λογαριθμική γραμμική προσαρμογή του δείκτη μοριακής μάζας. Λωρίδα 1, mRNA SARS-CoV. λωρίδα 2, mRNA κυττάρων Vero Ε6. λωρίδα 3, δείκτης μοριακής μάζας, μεγέθη σε kB.

ΑΚΟΛΟΥΘΗ ΛΙΣΤΑ

Οι αλληλουχίες νουκλεϊκών και αμινοξέων που απαριθμούνται στη συνοδευτική λίστα αλληλουχιών παρουσιάζονται χρησιμοποιώντας τυπικές συντομογραφίες γραμμάτων για τις βάσεις νουκλεοτιδίων και κωδικό τριών γραμμάτων για αμινοξέα, όπως ορίζεται στο 37 CFR 1.822. Εμφανίζεται μόνο ένας κλώνος από κάθε αλληλουχία νουκλεϊκών οξέων, αλλά ο συμπληρωματικός κλώνος νοείται ότι περιλαμβάνεται από οποιαδήποτε αναφορά στον εμφανιζόμενο κλώνο. Στη συνοδευτική λίστα ακολουθιών:

Η αλληλουχία αρ. 1 δείχνει την αλληλουχία νουκλεϊκών οξέων του γονιδιώματος SARS-CoV.

Η αλληλουχία αρ. 2 δείχνει την αλληλουχία αμινοξέων της πολυπρωτεΐνης SARS-CoV 1a (κωδικοποιημένη από νουκλεϊκό οξύ 265 σε νουκλεϊκό οξύ 13,398 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 3 δείχνει την αλληλουχία αμινοξέων της πολυπρωτεΐνης SARS-CoV 1b (κωδικοποιημένη από νουκλεϊκό οξύ 13,398 έως 21,482 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 4 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV S (κωδικοποιείται από νουκλεϊκό οξύ 21,492 έως 25,256 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 5 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Χ1 (κωδικοποιείται από νουκλεϊκό οξύ 25,268 έως 26,089 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 6 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Χ2 (κωδικοποιείται από νουκλεϊκό οξύ 25,689 έως 26,150 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 7 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Ε (κωδικοποιημένη από νουκλεϊκό οξύ 26,117 έως 26,344 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 8 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Μ (κωδικοποιημένη από νουκλεϊκό οξύ 26,398 έως 27,060 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 9 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV X3 (κωδικοποιείται από νουκλεϊκό οξύ 27.074 έως 27.262 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 10 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Χ4 (κωδικοποιείται από νουκλεϊκό οξύ 27,273 έως 27,638 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 11 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Χ5 (κωδικοποιείται από νουκλεϊκό οξύ 27.864 έως 28.115 της αλληλουχίας αρ. 1).

Η αλληλουχία αρ. 12 δείχνει την αλληλουχία αμινοξέων της πρωτεΐνης SARS-CoV Ν (κωδικοποιείται από νουκλεϊκό οξύ 28.120 έως 29.385 της αλληλουχίας αρ. 1).

SEQ ID ΝΟ: 13-15 δείχνουν την αλληλουχία νουκλεϊκού οξέος αρκετών ειδικών για SARS-CoV ολιγονουκλεοτιδικών εκκινητών.

SEQ ID ΝΟ: 16-33 δείχνουν την αλληλουχία νουκλεϊκού οξέος πολλών ολιγονουκλεοτιδικών εκκινητών/ανιχνευτών που χρησιμοποιούνται για δοκιμές SARS-CoV αντίστροφης μεταγραφής-πολυμεράσης (RT-PCR).

SEQ ID ΝΟ: 34-35 δείχνουν την αλληλουχία νουκλεϊκού οξέος δύο εκφυλισμένων εκκινητών που έχουν σχεδιαστεί για την ανόπτηση σε θέσεις που κωδικοποιούν συντηρημένα μοτίβα αμινοξέων κοροναϊού.

SEQ ID ΝΟ: 36-38 δείχνουν την αλληλουχία νουκλεϊκού οξέος πολλών ολιγονουκλεοτιδικών εκκινητών/ανιχνευτών που χρησιμοποιούνται ως μάρτυρες σε δοκιμασίες RT-PCR σε πραγματικό χρόνο.

ΛΕΠΤΟΜΕΡΗΣ ΠΕΡΙΓΡΑΦΗ ΠΟΛΛΩΝ ΣΩΜΑΤΩΣΕΩΝI. Συντομογραφίες

BAL: βρογχοκυψελιδική πλύση

CPE: κυτταροπαθητικό αποτέλεσμα

Ε: διαμεμβρανική πρωτεΐνη κορωνοϊού

ELISA: ανοσορροφητική δοκιμασία συνδεδεμένη με ένζυμα

HE: πρωτεΐνη αιμοσυγκολλητινίνης-εστεράσης του κορωνοϊού

IFA: έμμεσο φθορίζον αντίσωμα

Μ: πρωτεΐνη μεμβράνης κορωνοϊού

Ν: νουκλεοπρωτεΐνη κορωνοϊού

ORF: ανοιχτό πλαίσιο ανάγνωσης

Αλυσιδωτή αντίδραση πολυμεράσης PCR

RACE: Ταχεία ενίσχυση 5 άκρων cDNA

RT-PCR: αντίστροφη αλυσιδωτή αντίδραση μεταγραφής-πολυμεράσης

S: πρωτεΐνη αιχμής του κορονοϊού

SARS: σοβαρό οξύ αναπνευστικό σύνδρομο

SARS-CoV: σοβαρός κορονοϊός που σχετίζεται με το οξύ αναπνευστικό σύνδρομο

TRS: μεταγραφική κανονιστική ακολουθία

II Οροι

Εκτός εάν αναφέρεται διαφορετικά, οι τεχνικοί όροι χρησιμοποιούνται σύμφωνα με τη συμβατική χρήση. Ορισμοί κοινών όρων στη μοριακή βιολογία μπορούν να βρεθούν στο Benjamin Lewin, Genes VII, δημοσιευμένο από την Oxford University Press, 2000 (ISBN 019879276X). Kendrew et al. (επιμ.), The Encyclopedia of Molecular Biology , που δημοσιεύτηκε από τους Blackwell Publishers, 1994 (ISBN 0632021829) · and Robert A. Meyers (επιμ.), Molecular Biology and Biotechnology: a Complete Desk Reference , δημοσιευμένο από Wiley, John & Sons, Inc., 1995 (ISBN 0471186341) · και άλλες παρόμοιες αναφορές.

Όπως χρησιμοποιείται εδώ, οι ενικοί όροι «a», «an» και «the» περιλαμβάνουν πληθυντικούς αναφορείς, εκτός εάν το πλαίσιο δείχνει σαφώς διαφορετικά. Ομοίως, η λέξη «ή» προορίζεται να περιλαμβάνει το «και» εκτός εάν το πλαίσιο δείχνει σαφώς διαφορετικά. Επίσης, όπως χρησιμοποιείται εδώ, ο όρος «περιλαμβάνει» σημαίνει «περιλαμβάνει». Ως εκ τούτου «περιλαμβάνει Α ή Β» σημαίνει τα Α, Β ή Α και Β. Πρέπει επίσης να γίνει κατανοητό ότι όλα τα μεγέθη νουκλεοτιδίων ή μεγέθη αμινοξέων και όλα τα επίπεδα μοριακού βάρους ή μοριακής μάζας, που δίνονται για νουκλεϊκά οξέα ή πολυπεπτίδια είναι κατά προσέγγιση , και παρέχονται για περιγραφή. Αν και μέθοδοι και υλικά παρόμοια ή ισοδύναμα με αυτά που περιγράφονται εδώ μπορούν να χρησιμοποιηθούν στην πράξη ή τον έλεγχο της παρούσας εφεύρεσης, οι κατάλληλες μέθοδοι και υλικά περιγράφονται παρακάτω. Όλες οι δημοσιεύσεις, αιτήσεις διπλωμάτων ευρεσιτεχνίας, διπλώματα ευρεσιτεχνίας, και άλλες αναφορές που αναφέρονται εδώ ενσωματώνονται με αναφορά στο σύνολό τους. Σε περίπτωση σύγκρουσης, η παρούσα προδιαγραφή, συμπεριλαμβανομένων των επεξηγήσεων των όρων, θα ελέγξει. Επιπλέον, τα υλικά, οι μέθοδοι και τα παραδείγματα είναι ενδεικτικά μόνο και δεν προορίζονται να είναι περιοριστικά.

Προκειμένου να διευκολυνθεί η ανασκόπηση των διαφόρων υλοποιήσεων αυτής της αποκάλυψης, παρέχονται οι ακόλουθες εξηγήσεις για συγκεκριμένους όρους:

Επικουρικό: Μια ουσία που ενισχύει μη ειδικά την ανοσοαπόκριση σε ένα αντιγόνο. Η ανάπτυξη επικουρικών εμβολίων για χρήση σε ανθρώπους αναθεωρείται στους Singh et al. ( Nat. Biotechnol. 17: 1075-1081, 1999), το οποίο αποκαλύπτει ότι, κατά τη δημοσίευσή του, τα άλατα αργιλίου και το μικρογαλάκτωμα MF59 είναι τα μόνα πρόσθετα εμβολίου που έχουν εγκριθεί για ανθρώπινη χρήση.

Ενίσχυση: Η ενίσχυση ενός μορίου νουκλεϊκού οξέος (π.χ., ένα μόριο DNA ή RNA) αναφέρεται στη χρήση μιας εργαστηριακής τεχνικής που αυξάνει τον αριθμό αντιγράφων ενός μορίου νουκλεϊκού οξέος σε ένα δείγμα. Ένα παράδειγμα ενίσχυσης είναι η αλυσιδωτή αντίδραση πολυμεράσης (PCR), στην οποία ένα δείγμα έρχεται σε επαφή με ένα ζεύγος ολιγονουκλεοτιδικών εκκινητών υπό συνθήκες που επιτρέπουν τον υβριδισμό των εκκινητών σε ένα πρότυπο νουκλεϊκού οξέος στο δείγμα. Οι εκκινητές επεκτείνονται υπό κατάλληλες συνθήκες, αποσυνδέονται από το πρότυπο, επανα-ανόπτονται, επεκτείνονται και διαχωρίζονται για να ενισχύσουν τον αριθμό αντιγράφων του νουκλεϊκού οξέος. Το προϊόν της ενίσχυσης μπορεί να χαρακτηριστεί με τέτοιες τεχνικές όπως ηλεκτροφόρηση, πρότυπα διάσπασης ενδονουκλεάσης περιορισμού, υβριδοποίηση ή απολίνωση ολιγονουκλεοτιδίου και/ή προσδιορισμό αλληλουχίας νουκλεϊκών οξέων.

Άλλα παραδείγματα μεθόδων ενίσχυσης περιλαμβάνουν ενίσχυση μετατόπισης κλώνου, όπως αποκαλύπτεται στο Δίπλωμα Ευρεσιτεχνίας Η.Π.Α. Νο. 5,744,311; ισοθερμική ενίσχυση χωρίς μεταγραφή, όπως αποκαλύπτεται στο Δίπλωμα Ευρεσιτεχνίας Η.Π.Α. Νο. 6,033,881; επισκευή ενίσχυσης αλυσιδωτής αντίδρασης, όπως αποκαλύπτεται στο WO 90/01069. ενίσχυση αλυσιδωτής αντίδρασης λιγάσης, όπως αποκαλύπτεται στο ΕΡ-Α-320,308. ενίσχυση αλυσίδας αντίδρασης λιγάσης γεμίσματος κενού, όπως αποκαλύπτεται στο Δίπλωμα Ευρεσιτεχνίας Η.Π.Α. Νο. 5,427,930; και ενίσχυση χωρίς μεταγραφή NASBA ™ RNA, όπως αποκαλύπτεται στο Δίπλωμα Ευρεσιτεχνίας Η.Π.Α. Νο. 6,025,134. Μια μέθοδος ενίσχυσης μπορεί να τροποποιηθεί, συμπεριλαμβανομένου για παράδειγμα με πρόσθετα βήματα ή σύζευξη της ενίσχυσης με άλλο πρωτόκολλο.

Ζώο: Ζωντανοί πολυκύτταροι σπονδυλωτοί οργανισμοί, μια κατηγορία που περιλαμβάνει, για παράδειγμα, θηλαστικά και πτηνά. Ο όρος θηλαστικό περιλαμβάνει τόσο ανθρώπινα όσο και μη θηλαστικά. Ομοίως, ο όρος «υποκείμενο» περιλαμβάνει τόσο ανθρώπινα όσο και κτηνιατρικά θέματα, για παράδειγμα, ανθρώπους, πρωτεύοντα εκτός ανθρώπου, σκύλους, γάτες, άλογα και αγελάδες.

Αντίσωμα: Μια πρωτεΐνη (ή σύμπλοκο πρωτεΐνης) που περιλαμβάνει ένα ή περισσότερα πολυπεπτίδια ουσιαστικά κωδικοποιημένα από γονίδια ανοσοσφαιρίνης ή θραύσματα γονιδίων ανοσοσφαιρίνης. Τα αναγνωρισμένα γονίδια ανοσοσφαιρίνης περιλαμβάνουν τα γονίδια kappa, λάμδα, άλφα, γάμμα, δέλτα, έψιλον και mu σταθερής περιοχής, καθώς και τα μυριάδες γονίδια μεταβλητής περιοχής ανοσοσφαιρίνης. Οι ελαφριές αλυσίδες ταξινομούνται είτε ως κάπα είτε ως λάμδα. Οι βαριές αλυσίδες ταξινομούνται ως γάμμα, μου, άλφα, δέλτα ή έψιλον, οι οποίες με τη σειρά τους καθορίζουν τις κατηγορίες ανοσοσφαιρινών, IgG, IgM, IgA, IgD και IgE, αντίστοιχα.

Η βασική δομική μονάδα ανοσοσφαιρίνης (αντισώματος) είναι γενικά ένα τετραμερές. Κάθε τετραμερές αποτελείται από δύο πανομοιότυπα ζεύγη πολυπεπτιδικών αλυσίδων, κάθε ζεύγος έχει μία «ελαφριά» (περίπου 25 kDa) και μία «βαριά» (περίπου 50-70 kDa) αλυσίδα. Το Ν-άκρο κάθε αλυσίδας ορίζει μια μεταβλητή περιοχή περίπου 100 έως 110 ή περισσότερων αμινοξέων που είναι κυρίως υπεύθυνα για την αναγνώριση αντιγόνου. Οι όροι «μεταβλητή ελαφριά αλυσίδα» (V L ) και «μεταβλητή βαριά αλυσίδα» (V H ) αναφέρονται, αντίστοιχα, σε αυτές τις ελαφρές και βαριές αλυσίδες

Όπως χρησιμοποιείται εδώ, ο όρος «αντισώματα» περιλαμβάνει άθικτες ανοσοσφαιρίνες καθώς και έναν αριθμό καλά χαρακτηρισμένων θραυσμάτων. Για παράδειγμα, τα Fabs, Fvs και Fvs μονής αλυσίδας (SCFvs) που συνδέονται με την πρωτεΐνη στόχο (ή επίτοπο μέσα σε μια πρωτεΐνη ή πρωτεΐνη σύντηξης) θα ήταν επίσης ειδικοί συνδετικοί παράγοντες για αυτήν την πρωτεΐνη (ή επίτοπο). Αυτά τα θραύσματα αντισωμάτων ορίζονται ως εξής: (1) Fab, το θραύσμα που περιέχει ένα μονοσθενές θραύσμα δέσμευσης αντιγόνου ενός μορίου αντισώματος που παράγεται με πέψη ολόκληρου του αντισώματος με το ένζυμο παπαΐνη για να αποδώσει μια ανέπαφη ελαφριά αλυσίδα και ένα τμήμα μιας βαριάς αλυσίδας ? (2) Fab ′, το θραύσμα ενός μορίου αντισώματος που λαμβάνεται με κατεργασία ολόκληρου του αντισώματος με πεψίνη, ακολουθούμενη από αναγωγή, για να αποδώσει μια άθικτη ελαφριά αλυσίδα και ένα τμήμα της βαριάς αλυσίδας. λαμβάνονται δύο θραύσματα Fab per ανά μόριο αντισώματος. (3) (Fab ′)2 , το θραύσμα του αντισώματος που λαμβάνεται με επεξεργασία ολόκληρου του αντισώματος με το ένζυμο πεψίνη χωρίς επακόλουθη αναγωγή. (4) F (ab ′) 2 , διμερές δύο θραυσμάτων Fab held που συγκρατούνται μαζί με δύο δισουλφιδικούς δεσμούς. (5) Fv, ένα γενετικά τροποποιημένο θραύσμα που περιέχει τη μεταβλητή περιοχή της ελαφριάς αλυσίδας και τη μεταβλητή περιοχή της βαριάς αλυσίδας εκφρασμένη σε δύο αλυσίδες. και (6) αντίσωμα μονής αλυσίδας, ένα γενετικά τροποποιημένο μόριο που περιέχει τη μεταβλητή περιοχή της ελαφριάς αλυσίδας, τη μεταβλητή περιοχή της βαριάς αλυσίδας, που συνδέεται με έναν κατάλληλο συνδετήρα πολυπεπτιδίου ως ένα γενετικά συντηγμένο μόριο μονής αλυσίδας. Οι μέθοδοι παρασκευής αυτών των θραυσμάτων είναι συνηθισμένες (βλέπε, για παράδειγμα, Harlow and Lane, Using Antitodies: A Laboratory Manual , CSHL, New York, 1999).

Τα αντισώματα για χρήση στις μεθόδους και τις συσκευές αυτής της αποκάλυψης μπορεί να είναι μονοκλωνικά ή πολυκλωνικά. Απλώς ως παράδειγμα, μπορούν να παρασκευαστούν μονοκλωνικά αντισώματα από υβριδώματα ποντικών σύμφωνα με την κλασική μέθοδο των Kohler και Milstein ( Nature 256: 495-97, 1975) ή μεθόδους αυτών. Λεπτομερείς διαδικασίες για την παραγωγή μονοκλωνικών αντισωμάτων περιγράφονται στο Harlow and Lane, Using Antibodies: A Laboratory Manual , CSHL, New York, 1999.

Αντιγόνο: Μια ένωση, σύνθεση ή ουσία που μπορεί να διεγείρει την παραγωγή αντισωμάτων ή απόκρισης Τ-κυττάρων σε ένα ζώο, συμπεριλαμβανομένων των συνθέσεων που εγχέονται ή απορροφώνται σε ένα ζώο. Ένα αντιγόνο αντιδρά με τα προϊόντα ειδικής χυμικής ή κυτταρικής ανοσίας, συμπεριλαμβανομένων αυτών που προκαλούνται από ετερόλογα ανοσογόνα. Σε μία υλοποίηση, ένα αντιγόνο είναι ένα αντιγόνο κορωνοϊού.

Δέσιμο ή σταθερή δέσμευση: Ένα ολιγονουκλεοτίδιο συνδέεται ή συνδέεται σταθερά με ένα νουκλεϊκό οξύ -στόχο εάν μια επαρκής ποσότητα ολιγονουκλεοτιδίου σχηματίζει ζεύγη βάσεων ή υβριδοποιείται με το νουκλεϊκό οξύ -στόχο, για να επιτρέψει την ανίχνευση αυτής της σύνδεσης. Η σύνδεση μπορεί να ανιχνευθεί είτε από φυσικές είτε από λειτουργικές ιδιότητες του στόχου: σύμπλεγμα ολιγονουκλεοτιδίων. Η σύνδεση μεταξύ ενός στόχου και ενός ολιγονουκλεοτιδίου μπορεί να ανιχνευθεί με οποιαδήποτε διαδικασία γνωστή σε έναν έμπειρο στην τέχνη, συμπεριλαμβανομένων δοκιμασιών λειτουργικής ή φυσικής σύνδεσης. Η δέσμευση μπορεί να ανιχνευθεί λειτουργικά καθορίζοντας εάν η σύνδεση έχει παρατηρήσιμη επίδραση σε μια βιοσυνθετική διαδικασία όπως η έκφραση ενός γονιδίου, η αντιγραφή του DNA, η μεταγραφή, η μετάφραση και τα παρόμοια.

Οι φυσικές μέθοδοι ανίχνευσης της δέσμευσης συμπληρωματικών κλώνων DNA ή RNA είναι πολύ γνωστές στην τεχνική και περιλαμβάνουν μεθόδους όπως DNase I ή χημικό αποτύπωμα, δοκιμασίες διάσπασης γέλης και διάσπασης συγγένειας, κηλίδες Northern, κηλίδες Southern, στίγματα κουκίδων και απορρόφηση φωτός διαδικασίες ανίχνευσης. Για παράδειγμα, μια μέθοδος που χρησιμοποιείται ευρέως, επειδή είναι τόσο απλή και αξιόπιστη, περιλαμβάνει την παρατήρηση μιας αλλαγής στην απορρόφηση φωτός ενός διαλύματος που περιέχει ένα ολιγονουκλεοτίδιο (ή ένα ανάλογο) και ένα νουκλεϊκό οξύ στόχο στα 220 έως 300 nm, όπως είναι η θερμοκρασία σιγά σιγά αυξήθηκε. Εάν το ολιγονουκλεοτίδιο ή το ανάλογο έχει συνδεθεί με τον στόχο του, υπάρχει μια ξαφνική αύξηση της απορρόφησης σε χαρακτηριστική θερμοκρασία καθώς το ολιγονουκλεοτίδιο (ή ανάλογο) και ο στόχος διαχωρίζονται ή λιώνουν.

Η σύνδεση μεταξύ ενός ολιγομερούς και του νουκλεϊκού οξέος -στόχου του χαρακτηρίζεται συχνά από τη θερμοκρασία (Τ m ) στην οποία το 50% του ολιγομερούς λιώνει από τον στόχο του. Ένα υψηλότερο Τ m σημαίνει ένα ισχυρότερο ή πιο σταθερό σύμπλοκο σε σχέση με ένα σύμπλεγμα με χαμηλότερο Τ m .

cDNA (συμπληρωματικό DNA): Ένα κομμάτι DNA που στερείται εσωτερικών, μη κωδικοποιητικών τμημάτων (εσώνων) και ρυθμιστικών αλληλουχιών που καθορίζουν τη μεταγραφή. Το cDNA συντίθεται στο εργαστήριο με αντίστροφη μεταγραφή από αγγελιοφόρο RNA που εξάγεται από κύτταρα.

Ηλεκτροφόρηση: Η ηλεκτροφόρηση αναφέρεται στη μετανάστευση φορτισμένων διαλυμένων ουσιών ή σωματιδίων σε υγρό μέσο υπό την επίδραση ενός ηλεκτρικού πεδίου. Οι ηλεκτροφορητικοί διαχωρισμοί χρησιμοποιούνται ευρέως για την ανάλυση μακρομορίων. Ιδιαίτερη σημασία έχει η ταυτοποίηση πρωτεϊνών και αλληλουχιών νουκλεϊκών οξέων. Τέτοιοι διαχωρισμοί μπορεί να βασίζονται σε διαφορές μεγέθους και/ή φόρτισης. Οι αλληλουχίες νουκλεοτιδίων έχουν ομοιόμορφο φορτίο και ως εκ τούτου διαχωρίζονται με βάση τις διαφορές στο μέγεθος. Η ηλεκτροφόρηση μπορεί να πραγματοποιηθεί σε ένα μη υποστηριζόμενο υγρό μέσο (για παράδειγμα, τριχοειδή ηλεκτροφόρηση), αλλά πιο συχνά το υγρό μέσο ταξιδεύει μέσα από ένα στερεό μέσο στήριξης. Τα πιο ευρέως χρησιμοποιούμενα υποστηρικτικά μέσα είναι πηκτές, για παράδειγμα, γέλες πολυακρυλαμιδίου και αγαρόζης.

Τα κόσκινα κοσκινίσματος (για παράδειγμα, αγαρόζη) εμποδίζουν τη ροή των μορίων. Το μέγεθος των πόρων του πηκτώματος καθορίζει το μέγεθος ενός μορίου που μπορεί να ρέει ελεύθερα μέσω της γέλης. Ο χρόνος για να ταξιδέψετε μέσα στο τζελ αυξάνεται καθώς αυξάνεται το μέγεθος του μορίου. Ως αποτέλεσμα, τα μικρά μόρια ταξιδεύουν μέσω της γέλης πιο γρήγορα από τα μεγάλα μόρια και έτσι προχωρούν περισσότερο από την περιοχή εφαρμογής του δείγματος από τα μεγαλύτερα μόρια, σε μια δεδομένη χρονική περίοδο. Τέτοια πηκτώματα χρησιμοποιούνται για διαχωρισμούς αλληλουχιών νουκλεοτιδίων βάσει μεγέθους.

Θραύσματα γραμμικού DNA μεταναστεύουν μέσω πηκτωμάτων αγαρόζης με κινητικότητα που είναι αντιστρόφως ανάλογη με το log 10 του μοριακού τους βάρους. Με τη χρήση πηκτωμάτων με διαφορετικές συγκεντρώσεις αγαρόζης, μπορούν να επιλυθούν διαφορετικά μεγέθη θραυσμάτων DNA. Υψηλότερες συγκεντρώσεις αγαρόζης διευκολύνουν τον διαχωρισμό μικρών DNA, ενώ οι χαμηλές συγκεντρώσεις αγαρόζης επιτρέπουν διαχωρισμό μεγαλύτερων DNA.

Υβριδισμός: Τα ολιγονουκλεοτίδια και τα ανάλογα τους υβριδοποιούνται με σύνδεση υδρογόνου, που περιλαμβάνει Watson-Crick, Hoogsteen ή ανάστροφο δεσμό υδρογόνου Hoogsteen, μεταξύ συμπληρωματικών βάσεων. Γενικά, το νουκλεϊκό οξύ αποτελείται από αζωτούχες βάσεις που είναι είτε πυριμιδίνες (κυτοσίνη (C), ουρακίλη (U) και θυμίνη (T)) είτε πουρίνες (αδενίνη (A) και γουανίνη (G)). Αυτές οι αζωτούχες βάσεις σχηματίζουν δεσμούς υδρογόνου μεταξύ μιας πυριμιδίνης και μιας πουρίνης και ο δεσμός της πυριμιδίνης με την πουρίνη αναφέρεται ως «σύζευξη βάσεων». Πιο συγκεκριμένα, το Α θα δεσμεύεται υδρογόνο με το Τ ή το Υ και το G θα δεσμεύεται με το Γ. Το «συμπληρωματικό» αναφέρεται στη σύζευξη βάσεων που συμβαίνει μεταξύ δύο διακριτών αλληλουχιών νουκλεϊκών οξέων ή δύο διακριτών περιοχών της ίδιας αλληλουχίας νουκλεϊκών οξέων.

«Ειδικά υβριδοποιήσιμα» και «ειδικά συμπληρωματικά» είναι όροι που υποδηλώνουν επαρκή βαθμό συμπληρωματικότητας, έτσι ώστε να υπάρχει σταθερή και ειδική σύνδεση μεταξύ του ολιγονουκλεοτιδίου (ή του αναλόγου του) και του στόχου DNA ή RNA. Το ανάλογο ολιγονουκλεοτιδίου ή ολιγονουκλεοτιδίου δεν χρειάζεται να είναι 100% συμπληρωματικό προς την αλληλουχία -στόχο για να είναι ειδικά υβριδοποιήσιμο. Ένα ολιγονουκλεοτίδιο ή ένα ανάλογο είναι ειδικά υβριδοποιήσιμο όταν η σύνδεση του ολιγονουκλεοτιδίου ή του αναλόγου με το μόριο DNA-στόχου ή RNA παρεμβαίνει στη φυσιολογική λειτουργία του στόχου DNA ή RNA και υπάρχει επαρκής βαθμός συμπληρωματικότητας για την αποφυγή μη ειδικής σύνδεσης του ολιγονουκλεοτιδίου ή αναλογικές με αλληλουχίες μη στόχους υπό συνθήκες όπου απαιτείται ειδική σύνδεση, για παράδειγμα υπό φυσιολογικές συνθήκες στην περίπτωση in vivo αναλύσεων ή συστημάτων.

Οι συνθήκες υβριδισμού που έχουν ως αποτέλεσμα συγκεκριμένους βαθμούς αυστηρότητας θα ποικίλουν ανάλογα με τη φύση της επιλεγμένης μεθόδου υβριδοποίησης και τη σύνθεση και το μήκος των υβριδοποιητικών αλληλουχιών νουκλεϊκών οξέων. Γενικά, η θερμοκρασία του υβριδισμού και η ιοντική ισχύς (ειδικά η συγκέντρωση Na + και/ή Mg ++ ) του ρυθμιστικού υβριδισμού θα καθορίσουν την αυστηρότητα του υβριδισμού, αν και οι χρόνοι πλύσης επηρεάζουν επίσης την αυστηρότητα. Οι υπολογισμοί σχετικά με τις συνθήκες υβριδισμού που απαιτούνται για την επίτευξη συγκεκριμένων βαθμών αυστηρότητας συζητούνται από τους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 ndεκδ., τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ΝΥ, 1989, κεφάλαια 9 και 11. και Ausubel et αϊ. Short Protocols in Molecular Biology, 4 η έκδ., John Wiley & Sons, Inc., 1999.

Για τους σκοπούς της παρούσας αποκάλυψης, οι «αυστηρές συνθήκες» περιλαμβάνουν συνθήκες υπό τις οποίες ο υβριδισμός θα συμβεί μόνο εάν υπάρχει μικρότερη από 25% αναντιστοιχία μεταξύ του μορίου υβριδισμού και της αλληλουχίας στόχου. Οι «αυστηρές συνθήκες» μπορούν να χωριστούν σε συγκεκριμένα επίπεδα αυστηρότητας για πιο ακριβή ορισμό. Έτσι, όπως χρησιμοποιείται εδώ, οι συνθήκες «μέτριας αυστηρότητας» είναι εκείνες κάτω από τις οποίες μόρια με αναντιστοιχία αλληλουχίας άνω του 25% δεν θα υβριδοποιηθούν. συνθήκες «μεσαίας αυστηρότητας» είναι εκείνες κάτω από τις οποίες μόρια με ασυμφωνία άνω του 15% δεν θα υβριδοποιηθούν και συνθήκες «υψηλής αυστηρότητας» είναι εκείνες κάτω από τις οποίες ακολουθίες με αναντιστοιχία άνω του 10% δεν θα υβριδοποιηθούν. Οι συνθήκες «πολύ υψηλής αυστηρότητας» είναι αυτές κάτω από τις οποίες ακολουθίες με αναντιστοιχία άνω του 6% δεν θα υβριδοποιηθούν.

Ανοσοδιεγερτική σύνθεση: Ένας όρος που χρησιμοποιείται εδώ για να σημαίνει μια σύνθεση χρήσιμη για διέγερση ή πρόκληση συγκεκριμένης ανοσοαπόκρισης (ή ανοσογονικής απόκρισης) σε σπονδυλωτό. Σε ορισμένες εφαρμογές, η ανοσογόνος απόκριση είναι προστατευτική ή παρέχει προστατευτική ανοσία, καθόσον επιτρέπει στο σπονδυλωτό ζώο να αντισταθεί καλύτερα στη μόλυνση ή στην εξέλιξη της νόσου από τον οργανισμό εναντίον του οποίου στρέφεται το εμβόλιο.

Χωρίς να επιθυμούμε να δεσμευτούμε από μια συγκεκριμένη θεωρία, πιστεύεται ότι μια ανοσογονική απόκριση μπορεί να προκύψει από τη δημιουργία ενός αντισώματος ειδικά για έναν ή περισσότερους από τους επιτόπους που παρέχονται στην ανοσοδιεγερτική σύνθεση. Εναλλακτικά, η απόκριση μπορεί να περιλαμβάνει μία Τ-βοηθητική ή κυτταροτοξική κυτταρική απάντηση σε έναν ή περισσότερους από τους επιτόπους που παρέχονται στην ανοσοδιεγερτική σύνθεση. Και οι τρεις αυτές απαντήσεις μπορεί να προέρχονται από αφελή ή κύτταρα μνήμης. Ένα συγκεκριμένο παράδειγμα ενός τύπου ανοσοδιεγερτικής σύνθεσης είναι ένα εμβόλιο.

Σε ορισμένες εφαρμογές, μια «αποτελεσματική ποσότητα» ή «ανοσοδιεγερτική ποσότητα» μιας ανοσοδιεγερτικής σύνθεσης είναι μια ποσότητα η οποία, όταν χορηγείται σε ένα άτομο, είναι επαρκής για να προκαλέσει ανιχνεύσιμη ανοσοαπόκριση. Μια τέτοια απόκριση μπορεί να περιλαμβάνει, για παράδειγμα, δημιουργία αντισώματος ειδικό για έναν ή περισσότερους από τους επιτόπους που παρέχονται στην ανοσοδιεγερτική σύνθεση. Εναλλακτικά, η απόκριση μπορεί να περιλαμβάνει μια απόκριση Τ-βοηθητική ή βασισμένη σε CTL σε έναν ή περισσότερους από τους επιτόπους που παρέχονται στην ανοσοδιεγερτική σύνθεση. Και οι τρεις αυτές απαντήσεις μπορεί να προέρχονται από αφελή ή κύτταρα μνήμης. Σε άλλες υλοποιήσεις, μια «προστατευτική αποτελεσματική ποσότητα» μιας σύνθεσης ανοσοδιεγέρσεως είναι μια ποσότητα η οποία, όταν χορηγείται σε ένα άτομο, είναι επαρκής για να προσδώσει προστατευτική ανοσία στο υποκείμενο.

Αναστολή ή αντιμετώπιση μιας νόσου: Αναστολή της πλήρους ανάπτυξης μιας νόσου ή κατάστασης, για παράδειγμα, σε ένα άτομο που κινδυνεύει για μια ασθένεια όπως ο SARS. Η «θεραπεία» αναφέρεται σε μια θεραπευτική παρέμβαση που βελτιώνει ένα σημάδι ή σύμπτωμα μιας νόσου ή παθολογικής κατάστασης αφού έχει αρχίσει να αναπτύσσεται. Όπως χρησιμοποιείται εδώ, ο όρος «βελτίωση», σε σχέση με μια ασθένεια, παθολογική κατάσταση ή σύμπτωμα, αναφέρεται σε οποιαδήποτε παρατηρήσιμη ευεργετική επίδραση της θεραπείας. Το ευεργετικό αποτέλεσμα μπορεί να αποδειχθεί, για παράδειγμα, με καθυστερημένη εμφάνιση κλινικών συμπτωμάτων της νόσου σε ευαίσθητο άτομο, μείωση της σοβαρότητας ορισμένων ή όλων των κλινικών συμπτωμάτων της νόσου, βραδύτερη εξέλιξη της νόσου, μείωση του αριθμός υποτροπών της νόσου, βελτίωση της συνολικής υγείας ή ευημερίας του ατόμου,

Απομονωμένος: Ένας «απομονωμένος» μικροοργανισμός (όπως ιός, βακτήριο, μύκητας ή πρωτόζωο) έχει διαχωριστεί ή καθαριστεί ουσιαστικά μακριά από μικροοργανισμούς διαφορετικών τύπων, στελεχών ή ειδών. Οι μικροοργανισμοί μπορούν να απομονωθούν με μια ποικιλία τεχνικών, συμπεριλαμβανομένης της σειριακής αραίωσης και καλλιέργειας.

Ένα «απομονωμένο» βιολογικό συστατικό (όπως ένα μόριο νουκλεϊκού οξέος, πρωτεΐνη ή οργανίδιο) έχει διαχωριστεί ουσιαστικά ή καθαριστεί μακριά από άλλα βιολογικά συστατικά στο κύτταρο του οργανισμού στο οποίο το συστατικό βρίσκεται φυσικά, όπως άλλα χρωμοσωμικά και εξωχρωμοσωμικά DNA και RNA, πρωτεΐνες και οργανίδια. Τα νουκλεϊκά οξέα και οι πρωτεΐνες που έχουν «απομονωθεί» περιλαμβάνουν νουκλεϊκά οξέα και πρωτεΐνες που έχουν καθαριστεί με τυπικές μεθόδους καθαρισμού. Ο όρος περιλαμβάνει επίσης νουκλεϊκά οξέα και πρωτεΐνες που παρασκευάζονται με ανασυνδυασμένη έκφραση σε ένα κύτταρο ξενιστή, καθώς και χημικά συντεθειμένα νουκλεϊκά οξέα ή πρωτεΐνες, ή θραύσματα αυτών.

Ετικέτα: Μια ανιχνεύσιμη ένωση ή σύνθεση που συζεύγεται άμεσα ή έμμεσα σε άλλο μόριο για να διευκολύνει την ανίχνευση αυτού του μορίου. Συγκεκριμένα, μη περιοριστικά παραδείγματα ετικετών περιλαμβάνουν φθορίζουσες ετικέτες, ενζυματικούς δεσμούς και ραδιενεργά ισότοπα.

Μόριο νουκλεϊνικού οξέος: Μια πολυμερής μορφή νουκλεοτιδίων, η οποία μπορεί να περιλαμβάνει τόσο νοήματα όσο και αντι-λογικά σκέλη RNA, cDNA, γονιδιωματικό DNA και συνθετικές μορφές και μικτά πολυμερή των παραπάνω. Ένα νουκλεοτίδιο αναφέρεται σε ένα ριβονουκλεοτίδιο, δεοξυνουκλεοτίδιο ή μια τροποποιημένη μορφή οποιουδήποτε τύπου νουκλεοτιδίου. Ένα «μόριο νουκλεϊκού οξέος» όπως χρησιμοποιείται εδώ είναι συνώνυμο με το «νουκλεϊκό οξύ» και «πολυνουκλεοτίδιο». Ένα μόριο νουκλεϊκού οξέος έχει συνήθως τουλάχιστον 10 βάσεις σε μήκος, εκτός αν ορίζεται διαφορετικά. Ο όρος περιλαμβάνει μονόκλινες και δίκλωνες μορφές DNA. Ένα πολυνουκλεοτίδιο μπορεί να περιλαμβάνει είτε ή αμφότερα φυσικώς απαντώμενα είτε τροποποιημένα νουκλεοτίδια που συνδέονται μεταξύ τους με φυσικώς απαντώμενους και/ή μη φυσικούς νουκλεοτιδικούς δεσμούς.

Ολιγονουκλεοτίδιο: Ένα μόριο νουκλεϊκού οξέος που γενικά περιλαμβάνει μήκος 300 βάσεις ή λιγότερα. Ο όρος συχνά αναφέρεται σε μονόκλωνα δεοξυριβονουκλεοτίδια, αλλά μπορεί επίσης να αναφέρεται σε μονόκλωνο ή δίκλωνο ριβονουκλεοτίδια, RNA: υβρίδια DNA και δίκλωνους DNA, μεταξύ άλλων. Ο όρος «ολιγονουκλεοτίδιο» περιλαμβάνει επίσης ολιγονουκλεοσίδια (δηλαδή, ολιγονουκλεοτίδιο μείον το φωσφορικό άλας) και οποιοδήποτε άλλο πολυμερές οργανικής βάσης. Σε μερικά παραδείγματα, τα ολιγονουκλεοτίδια έχουν μήκος περίπου 10 έως περίπου 90 βάσεις, για παράδειγμα, μήκος 12, 13, 14, 15, 16, 17, 18, 19 ή 20 βάσεις. Άλλα ολιγονουκλεοτίδια είναι περίπου 25, περίπου 30, περίπου 35, περίπου 40, περίπου 45, περίπου 50, περίπου 55, περίπου 60 βάσεις, περίπου 65 βάσεις, περίπου 70 βάσεις, περίπου 75 βάσεις ή περίπου 80 βάσεις σε μήκος. Τα ολιγονουκλεοτίδια μπορεί να είναι μονόκλωνα, για παράδειγμα, για χρήση ως ανιχνευτές ή εκκινητές, ή μπορεί να είναι δίκλωνος, για παράδειγμα, για χρήση στην κατασκευή ενός μεταλλαγμένου γονιδίου. Τα ολιγονουκλεοτίδια μπορούν να είναι ολιγονουκλεοτίδια είτε με νόημα είτε με αντίληψη. Ένα ολιγονουκλεοτίδιο μπορεί να τροποποιηθεί όπως συζητήθηκε παραπάνω σε σχέση με μόρια νουκλεϊκού οξέος. Τα ολιγονουκλεοτίδια μπορούν να ληφθούν από υπάρχουσες πηγές νουκλεϊκών οξέων (για παράδειγμα, γονιδιωματικό ή cDNA), αλλά μπορούν επίσης να είναι συνθετικά (για παράδειγμα, παραγόμενα από εργαστηριακή ή in vitro σύνθεση ολιγονουκλεοτιδίων).

Ανοικτό πλαίσιο ανάγνωσης (ORF): Μια σειρά τριπλετών νουκλεοτιδίων (κωδικόνια) που κωδικοποιούν αμινοξέα χωρίς εσωτερικά κωδικόνια τερματισμού. Αυτές οι αλληλουχίες είναι συνήθως μεταφράσιμες σε πεπτίδιο/πολυπεπτίδιο/πρωτεΐνη/πολυπρωτεΐνη.

Λειτουργικά Συνδεδεμένο: Μια πρώτη αλληλουχία νουκλεϊκού οξέος συνδέεται λειτουργικά με μια δεύτερη αλληλουχία νουκλεϊκού οξέος όταν η πρώτη αλληλουχία νουκλεϊκού οξέος τοποθετείται σε μια λειτουργική σχέση με τη δεύτερη αλληλουχία νουκλεϊκού οξέος. Για παράδειγμα, ένας προαγωγέας συνδέεται λειτουργικά με μια κωδικοποιητική αλληλουχία εάν ο προαγωγέας επηρεάζει τη μεταγραφή ή την έκφραση της κωδικοποιητικής αλληλουχίας. Γενικά, οι λειτουργικά συνδεδεμένες αλληλουχίες DNA είναι συνεχόμενες και, όπου είναι απαραίτητο, για να ενώσουν δύο περιοχές κωδικοποίησης πρωτεϊνών, στο ίδιο πλαίσιο ανάγνωσης. Εάν υπάρχουν ιντρόνια, οι λειτουργικά συνδεδεμένες αλληλουχίες DNA μπορεί να μην είναι συνεχόμενες.

Φαρμακευτικώς αποδεκτοί φορείς: Οι φαρμακευτικώς αποδεκτοί φορείς χρήσιμοι σε αυτήν την αποκάλυψη είναι συμβατικοί. Η Remington’s Pharmaceutical Sciences , από τον EW Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), περιγράφει συνθέσεις και σκευάσματα κατάλληλα για φαρμακευτική χορήγηση μίας ή περισσοτέρων θεραπευτικών ενώσεων ή μορίων, όπως ένα ή περισσότερα νουκλεϊκά SARS-CoV μόρια οξέος, πρωτεΐνες ή αντισώματα που δεσμεύουν αυτές τις πρωτεΐνες και επιπλέον φαρμακευτικοί παράγοντες.

Γενικά, η φύση του φορέα θα εξαρτηθεί από τον συγκεκριμένο τρόπο χορήγησης που χρησιμοποιείται. Για παράδειγμα, τα παρεντερικά σκευάσματα συνήθως περιλαμβάνουν ενέσιμα υγρά που περιλαμβάνουν φαρμακευτικά και φυσιολογικά αποδεκτά υγρά όπως νερό, φυσιολογικό αλατούχο διάλυμα, ισορροπημένα διαλύματα άλατος, υδατική δεξτρόζη, γλυκερόλη ή παρόμοια ως φορέα. Για στερεές συνθέσεις (για παράδειγμα, σκόνες, χάπια, δισκία ή μορφές κάψουλας), οι συμβατικοί μη τοξικοί στερεοί φορείς μπορούν να περιλαμβάνουν, για παράδειγμα, φαρμακευτικούς βαθμούς μαννιτόλης, λακτόζης, αμύλου ή στεατικού μαγνησίου. Εκτός από τους βιολογικά ουδέτερους φορείς, οι φαρμακευτικές συνθέσεις που πρόκειται να χορηγηθούν μπορούν να περιέχουν μικρές ποσότητες μη τοξικών βοηθητικών ουσιών, όπως διαβρεκτικούς ή γαλακτωματοποιητικούς παράγοντες, συντηρητικά και ρυθμιστικά μέσα pH και παρόμοια,

Πολυπεπτίδιο: Ένα πολυμερές στο οποίο τα μονομερή είναι υπολείμματα αμινοξέων τα οποία ενώνονται μεταξύ τους μέσω αμιδικών δεσμών. Όταν τα αμινοξέα είναι άλφα-αμινοξέα, μπορεί να χρησιμοποιηθεί είτε το L-οπτικό ισομερές είτε το D-οπτικό ισομερές, προτιμώντας τα L-ισομερή. Οι όροι «πολυπεπτίδιο» ή «πρωτεΐνη» όπως χρησιμοποιούνται εδώ προορίζονται να περιλαμβάνουν οποιαδήποτε αλληλουχία αμινοξέων και περιλαμβάνουν τροποποιημένες αλληλουχίες όπως γλυκοπρωτεΐνες. Ο όρος «πολυπεπτίδιο» προορίζεται ειδικά για να καλύψει τις φυσικές πρωτεΐνες, καθώς και εκείνες που παράγονται ανασυνδυαστικά ή συνθετικά.

Συντηρητικές υποκαταστάσεις αμινοξέων είναι εκείνες οι υποκαταστάσεις που, όταν γίνονται, παρεμβαίνουν λιγότερο στις ιδιότητες της αρχικής πρωτεΐνης, δηλαδή η δομή και κυρίως η λειτουργία της πρωτεΐνης διατηρείται και δεν αλλάζει σημαντικά από τέτοιες υποκαταστάσεις. Παραδείγματα συντηρητικών υποκαταστάσεων φαίνονται παρακάτω.

Αρχικό υπόλειμμα

Συντηρητικές υποκαταστάσεις

Ο Αλ

Να είναι

Θυμωμένος

Λίστα

Asn

Gln, Του

Ασπίδα

Glu

Cys

Να είναι

Gln

Asn

Glu

Ασπίδα

Του

Asn? Gln

Με

Λέι, Βαλ

λιοντάρι

Με; Val

Λίστα

Arg; Gln; Glu

Του

Λιοντάρι; αρχές

Phe

Συνάντησε; Leu; Tyr

Να είναι

Thr

Thr

Να είναι

Trp

Tyr

Tyr

Trp; Phe

Val

Ile? λιοντάρι

Οι συντηρητικές υποκαταστάσεις διατηρούν γενικά (α) τη δομή του πολυπεπτιδικού σκελετού στην περιοχή της υποκατάστασης, για παράδειγμα, ως φύλλο ή ελικοειδή διαμόρφωση, (β) το φορτίο ή την υδροφοβία του μορίου στη θέση -στόχο, ή (γ) το το μεγαλύτερο μέρος της πλευρικής αλυσίδας.

Οι υποκαταστάσεις που γενικά αναμένεται να παράγουν τις μεγαλύτερες αλλαγές στις ιδιότητες της πρωτεΐνης θα είναι μη συντηρητικές, για παράδειγμα αλλαγές στις οποίες (α) ένα υδρόφιλο υπόλειμμα, για παράδειγμα, σερίλιο ή θρεονύλιο, υποκαθίσταται (ή από) ένα υδρόφοβο υπόλειμμα , για παράδειγμα, λευκύλιο, ισολευκύλιο, φαινυλαλανύλιο, βαλύλιο ή αλανύλιο · β) μια κυστεΐνη ή προλίνη αντικαθίσταται (ή από) οποιοδήποτε άλλο υπόλειμμα · γ) ένα υπόλειμμα που έχει μια ηλεκτροθετική πλευρική αλυσίδα, για παράδειγμα, λυσύλιο, αργινύλιο ή ισταδύλιο, υποκαθίσταται (ή από) ένα ηλεκτροαρνητικό υπόλειμμα, για παράδειγμα, γλουταμύλιο ή ασπαρτύλιο · ή (δ) ένα υπόλειμμα που έχει μια ογκώδη πλευρική αλυσίδα, για παράδειγμα, φαινυλαλανίνη, υποκαθίσταται (ή από) ένα που δεν έχει μια πλευρική αλυσίδα, για παράδειγμα, γλυκίνη.

Ανιχνευτές και εκκινητές: Ένας ανιχνευτής περιλαμβάνει ένα απομονωμένο νουκλεϊκό οξύ προσαρτημένο σε ανιχνεύσιμη ετικέτα ή άλλο μόριο αναφοράς. Οι τυπικές ετικέτες περιλαμβάνουν ραδιενεργά ισότοπα, υποστρώματα ενζύμων, συν-παράγοντες, υποκαταστάτες, χημειοφωταύγειες ή φθορίζουσες ουσίες, απτένια και ένζυμα. Οι μέθοδοι επισήμανσης και καθοδήγησης στην επιλογή ετικετών κατάλληλων για διάφορους σκοπούς συζητούνται, για παράδειγμα, στους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 nd ed., Τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 και Ausubel et al. Short Protocols in Molecular Biology, 4 η έκδ., John Wiley & Sons, Inc., 1999.

Οι εκκινητές είναι βραχεία μόρια νουκλεϊκού οξέος, για παράδειγμα ολιγονουκλεοτίδια DNA 10 νουκλεοτίδια ή περισσότερα σε μήκος, για παράδειγμα που υβριδοποιούνται σε γειτονικά συμπληρωματικά νουκλεοτίδια ή μια αλληλουχία που πρόκειται να ενισχυθεί. Τα μακρύτερα ολιγονουκλεοτίδια DNA μπορεί να έχουν μήκος περίπου 15, 20, 25, 30 ή 50 νουκλεοτίδια ή περισσότερα. Οι εκκινητές μπορούν να ανοπτηθούν σε ένα συμπληρωματικό κλώνο στόχου DNA με υβριδισμό νουκλεϊκού οξέος για να σχηματίσουν ένα υβρίδιο μεταξύ του εκκινητή και του κλώνου DNA -στόχου, και στη συνέχεια ο εκκινητής να επεκταθεί κατά μήκος του κλώνου DNA στόχου από ένα ένζυμο πολυμεράσης DNA. Τα ζεύγη εκκινητών μπορούν να χρησιμοποιηθούν για ενίσχυση αλληλουχίας νουκλεϊνικού οξέος, για παράδειγμα, με την PCR ή άλλες μεθόδους ενίσχυσης νουκλεϊκού οξέος γνωστές στην τεχνική, όπως περιγράφεται παραπάνω.

Μέθοδοι παρασκευής και χρήσης ανιχνευτών και εκκινητών νουκλεϊνικού οξέος περιγράφονται, για παράδειγμα, στους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 nd ed., Τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ΝΥ, 1989; Ausubel et αϊ. Short Protocols in Molecular Biology, 4 η έκδ., John Wiley & Sons, Inc., 1999; και Innis et αϊ. PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, Calif., 1990. Τα ζεύγη εκκινητών ενίσχυσης μπορούν να προέλθουν από μια γνωστή ακολουθία, για παράδειγμα, χρησιμοποιώντας προγράμματα υπολογιστών που προορίζονται για αυτόν τον σκοπό όπως το Primer (Έκδοση 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Κάποιος με συνηθισμένη εμπειρία στην τέχνη θα εκτιμήσει ότι η ιδιαιτερότητα ενός συγκεκριμένου καθετήρα ή αστάρι αυξάνεται με το μήκος του. Έτσι, για να επιτευχθεί μεγαλύτερη εξειδίκευση, μπορούν να επιλεγούν ανιχνευτές και εκκινητές που περιλαμβάνουν τουλάχιστον 20, 25, 30, 35, 40, 45, 50 ή περισσότερα διαδοχικά νουκλεοτίδια μιας αλληλουχίας νουκλεοτιδίων στόχου.

Πρωτεΐνη: Ένα βιολογικό μόριο, ιδιαίτερα ένα πολυπεπτίδιο, που εκφράζεται από ένα γονίδιο και αποτελείται από αμινοξέα. Μια «πολυπρωτεΐνη» είναι μια πρωτεΐνη που, μετά τη σύνθεση, διασπάται για να παράγει αρκετά λειτουργικά διακριτά πολυπεπτίδια.

Καθαρισμένος: Ο όρος «καθαρισμένος» δεν απαιτεί απόλυτη καθαρότητα. μάλλον, προορίζεται ως σχετικός όρος. Έτσι, για παράδειγμα, ένα καθαρισμένο παρασκεύασμα πρωτεΐνης είναι αυτό στο οποίο η υποκείμενη πρωτεΐνη είναι πιο καθαρή από ό, τι στο φυσικό της περιβάλλον εντός ενός κυττάρου. Γενικά, ένα παρασκεύασμα πρωτεΐνης καθαρίζεται έτσι ώστε η πρωτεΐνη να αντιπροσωπεύει τουλάχιστον το 50% της συνολικής πρωτεϊνικής περιεκτικότητας του παρασκευάσματος.

Ανασυνδυασμένο νουκλεϊκό οξύ: Μια αλληλουχία που δεν απαντάται φυσικά ή έχει μια αλληλουχία που δημιουργείται από έναν τεχνητό συνδυασμό δύο διαφορετικά διαχωρισμένων τμημάτων αλληλουχίας. Αυτός ο τεχνητός συνδυασμός επιτυγχάνεται συχνά με χημική σύνθεση ή, συνηθέστερα, με τεχνητό χειρισμό μεμονωμένων τμημάτων νουκλεϊκών οξέων, για παράδειγμα, με τεχνικές γενετικής μηχανικής όπως αυτές που περιγράφονται στους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 nd ed., Τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ΝΥ, 1989. Ο όρος ανασυνδυασμένος περιλαμβάνει νουκλεϊκά οξέα που έχουν τροποποιηθεί μόνο με προσθήκη, υποκατάσταση ή διαγραφή τμήματος του νουκλεϊκού οξέος.

Δείγμα: Ένα τμήμα, κομμάτι ή τμήμα που είναι αντιπροσωπευτικό ενός συνόλου. Ο όρος αυτός περιλαμβάνει οποιοδήποτε υλικό, συμπεριλαμβανομένων για παράδειγμα δειγμάτων που λαμβάνονται από ένα ζώο, ένα φυτό ή το περιβάλλον.

Ένα «περιβαλλοντικό δείγμα» περιλαμβάνει ένα δείγμα που λαμβάνεται από άψυχα αντικείμενα ή δεξαμενές σε εσωτερικό ή εξωτερικό περιβάλλον. Περιβαλλοντικά δείγματα περιλαμβάνουν, αλλά δεν περιορίζονται σε αυτά: δείγματα εδάφους, νερού, σκόνης και αέρα. μαζικά δείγματα, συμπεριλαμβανομένων οικοδομικών υλικών, επίπλων και περιεχομένων χωματερών · και άλλα δείγματα δεξαμενής, όπως ζωικά απορρίμματα, συγκομισμένοι κόκκοι και τρόφιμα.

«Βιολογικό δείγμα» είναι ένα δείγμα που λαμβάνεται από υποκείμενο φυτού ή ζώου. Όπως χρησιμοποιείται εδώ, τα βιολογικά δείγματα περιλαμβάνουν όλα τα δείγματα χρήσιμα για την ανίχνευση ιογενούς λοίμωξης σε άτομα, συμπεριλαμβανομένων, αλλά χωρίς περιορισμό: κυττάρων, ιστών και σωματικών υγρών, όπως αίματος. παράγωγα και κλάσματα αίματος (όπως ορός). εξαγόμενα χολικά? βιοψία ή αφαιρεμένος χειρουργικός ιστός, συμπεριλαμβανομένων ιστών που είναι, για παράδειγμα, μη στερεωμένοι, κατεψυγμένοι, στερεωμένοι σε φορμαλίνη ή/και ενσωματωμένοι σε παραφίνη · δάκρυα; γάλα; απολέπιση δέρματος? επιφανειακές πλύσεις? ούρο; πτύελο; εγκεφαλονωτιαίο υγρό? υγρό του προστάτη? πύο; αναρροφάται ο μυελός των οστών. BAL? σάλιο; επιχρίσματα του τραχήλου της μήτρας? κολπικά επιχρίσματα? και στοματοφαρυγγικό πλύσιμο.

Ταυτότητα αλληλουχίας Η ομοιότητα μεταξύ δύο αλληλουχιών νουκλεϊκών οξέων ή δύο αλληλουχιών αμινοξέων, εκφράζεται με όρους ομοιότητας μεταξύ των αλληλουχιών, αλλιώς αναφέρεται ως ταυτότητα αλληλουχίας. Η ταυτότητα αλληλουχίας μετριέται συχνά με βάση το ποσοστό ταυτότητας (ή ομοιότητας ή ομολογίας). όσο υψηλότερο είναι το ποσοστό, τόσο πιο παρόμοιες είναι οι δύο ακολουθίες.

Μέθοδοι ευθυγράμμισης αλληλουχιών για σύγκριση είναι πολύ γνωστές στην τεχνική. Διάφορα προγράμματα και αλγόριθμοι ευθυγράμμισης περιγράφονται στο: Smith and Waterman ( Adv. Appl. Math., 2: 482, 1981). Needleman and Wunsch ( J. Μοί. Biol., 48: 443, 1970). Pearson and Lipman ( Proc. Natl. Acad. Sci., 85: 2444, 1988); Higgins and Sharp ( Gene, 73: 237-44, 1988); Higgins and Sharp ( CABIOS, 5: 151-53, 1989). Corpet et al. ( Nuc. Acids Res., 16: 10881-90, 1988); Huang et al. ( Comp. Appls Biosci., 8: 155-65, 1992); και Pearson et al. ( Meth. Mol. Biol., 24: 307-31, 1994). Altschul et αϊ. ( Nature Genet.,6: 119-29, 1994) παρουσιάζει μια λεπτομερή εξέταση των μεθόδων ευθυγράμμισης ακολουθιών και των υπολογισμών της ομολογίας.

Τα εργαλεία ευθυγράμμισης ALIGN (Myers and Miller, CABIOS4: 11-17, 1989) ή LFASTA (Pearson and Lipman, 1988) μπορούν να χρησιμοποιηθούν για την πραγματοποίηση συγκρίσεων ακολουθιών (Internet Programme © 1996, WR Pearson and the University of Virginia, “fasta20u63” version 2.0u63, ημερομηνία κυκλοφορίας Δεκέμβριος 1996) Το Το ALIGN συγκρίνει ολόκληρες αλληλουχίες μεταξύ τους, ενώ το LFASTA συγκρίνει περιοχές τοπικής ομοιότητας. Αυτά τα εργαλεία ευθυγράμμισης και τα αντίστοιχα σεμινάρια τους είναι διαθέσιμα στο Διαδίκτυο στον ιστότοπο της NCSA. Εναλλακτικά, για συγκρίσεις αλληλουχιών αμινοξέων άνω των 30 περίπου αμινοξέων, η συνάρτηση «Blast 2 sequences» μπορεί να χρησιμοποιηθεί χρησιμοποιώντας την προεπιλεγμένη μήτρα BLOSUM62 που έχει οριστεί σε προεπιλεγμένες παραμέτρους, (κόστος ύπαρξης κενού 11 και κόστος ανά κενό υπολειμμάτων του 1). Κατά την ευθυγράμμιση σύντομων πεπτιδίων (λιγότερα από περίπου 30 αμινοξέα), η ευθυγράμμιση πρέπει να πραγματοποιείται χρησιμοποιώντας τη συνάρτηση «ακολουθίες Blast 2″, χρησιμοποιώντας τον πίνακα PAM30 που έχει οριστεί στις προεπιλεγμένες παραμέτρους (ανοικτό κενό 9, κυρώσεις επέκτασης 1). Το σύστημα σύγκρισης αλληλουχιών BLAST διατίθεται, για παράδειγμα, από την ιστοσελίδα του NCBI. επίσης Altschul et al.,J. Mol. ΒίοΙ., 215: 403-10, 1990; Gish and States, Nature Genet., 3: 266-72, 1993; Madden et al., Meth. Enzymol., 266: 131-41, 1996; Altschul et αϊ., Nucleic Acids Res., 25: 3389-402, 1997; and Zhang and Madden, Genome Res., 7: 649-56, 1997.

Τα ορθολόγια (ισοδύναμα με πρωτεΐνες άλλων ειδών) πρωτεϊνών χαρακτηρίζονται σε ορισμένες περιπτώσεις από κατοχή ταυτότητας αλληλουχίας άνω του 75% που υπολογίζεται στην ευθυγράμμιση πλήρους μήκους με την αλληλουχία αμινοξέων συγκεκριμένης πρωτεΐνης χρησιμοποιώντας το ALIGN που έχει οριστεί σε προεπιλεγμένες παραμέτρους. Οι πρωτεΐνες με ακόμη μεγαλύτερη ομοιότητα με μια ακολουθία αναφοράς θα εμφανίζουν αυξανόμενη ποσοστιαία ταυτότητα όταν αξιολογούνται με αυτήν τη μέθοδο, όπως τουλάχιστον 80%, τουλάχιστον 85%, τουλάχιστον 90%, τουλάχιστον 92%, τουλάχιστον 95%ή τουλάχιστον 98% ταυτότητα ακολουθίας. Επιπλέον, η ταυτότητα αλληλουχίας μπορεί να συγκριθεί σε όλο το μήκος ενός ή και των δύο δεσμευτικών τομέων των αποκαλυπτόμενων πρωτεϊνών σύντηξης.

Όταν συγκρίνεται σημαντικά λιγότερο από ολόκληρη η αλληλουχία για ταυτότητα αλληλουχίας, οι ομόλογες αλληλουχίες τυπικά θα έχουν τουλάχιστον 80%ταυτότητα αλληλουχίας σε σύντομα παράθυρα 10-20 και μπορεί να έχουν ταυτότητες ακολουθίας τουλάχιστον 85%, τουλάχιστον 90%, τουλάχιστον 95%, ή τουλάχιστον 99% ανάλογα με την ομοιότητά τους με την ακολουθία αναφοράς. Η ταυτότητα αλληλουχίας σε τόσο σύντομα παράθυρα μπορεί να προσδιοριστεί χρησιμοποιώντας το LFASTA. οι μέθοδοι περιγράφονται στον ιστότοπο της NCSA. Ένας έμπειρος στην τέχνη θα εκτιμήσει ότι αυτά τα εύρη ταυτότητας αλληλουχίας παρέχονται μόνο για καθοδήγηση. είναι απολύτως πιθανό ότι θα μπορούσαν να ληφθούν πολύ σημαντικά ομόλογα που δεν εμπίπτουν στα όρια που προβλέπονται. Παρόμοιες έννοιες ομολογίας ισχύουν για τα νουκλεϊκά οξέα όπως περιγράφονται για την πρωτεΐνη.

Μια εναλλακτική ένδειξη ότι δύο μόρια νουκλεϊκού οξέος είναι στενά συνδεδεμένα είναι ότι τα δύο μόρια υβριδοποιούνται μεταξύ τους υπό αυστηρές συνθήκες. Οι αντιπροσωπευτικές συνθήκες υβριδισμού συζητούνται παραπάνω.

Οι αλληλουχίες νουκλεϊκών οξέων που δεν παρουσιάζουν υψηλό βαθμό ταυτότητας ενδέχεται ωστόσο να κωδικοποιήσουν παρόμοιες αλληλουχίες αμινοξέων, λόγω του εκφυλισμού του γενετικού κώδικα. Είναι κατανοητό ότι αλλαγές στην αλληλουχία νουκλεϊκών οξέων μπορούν να γίνουν χρησιμοποιώντας αυτόν τον εκφυλισμό για την παραγωγή πολλαπλών αλληλουχιών νουκλεϊκών οξέων που η καθεμία κωδικοποιεί ουσιαστικά την ίδια πρωτεΐνη.

Ειδικός δεσμευτικός παράγοντας: Ένας παράγοντας που συνδέεται ουσιαστικά μόνο με έναν καθορισμένο στόχο. Έτσι, ένας ειδικός για πρωτεΐνη συνδετικός παράγοντας δεσμεύει ουσιαστικά μόνο την καθορισμένη πρωτεΐνη, ή σε μια συγκεκριμένη περιοχή μέσα στην πρωτεΐνη. Όπως χρησιμοποιείται εδώ, ένας ειδικός για την πρωτεΐνη συνδετικός παράγοντας περιλαμβάνει αντισώματα και άλλους παράγοντες που συνδέονται ουσιαστικά με ένα καθορισμένο πολυπεπτίδιο. Τα αντισώματα μπορεί να είναι μονοκλωνικά ή πολυκλωνικά αντισώματα που είναι ειδικά για το πολυπεπτίδιο, καθώς και ανοσολογικά αποτελεσματικά τμήματα («θραύσματα») αυτών.

Ο προσδιορισμός ότι ένας συγκεκριμένος παράγοντας συνδέεται ουσιαστικά μόνο με ένα συγκεκριμένο πολυπεπτίδιο μπορεί εύκολα να γίνει χρησιμοποιώντας ή προσαρμόζοντας διαδικασίες ρουτίνας. Ένας κατάλληλος in vitro προσδιορισμός χρησιμοποιεί τη διαδικασία στυπώματος Western (περιγράφεται σε πολλά τυπικά κείμενα, συμπεριλαμβανομένων των Harlow and Lane, Using Antitodies: A Laboratory Manual , CSHL, New York, 1999).

Μετασχηματισμένο: Ένα «μετασχηματισμένο» κύτταρο είναι ένα κύτταρο στο οποίο έχει εισαχθεί μόριο νουκλεϊκού οξέος με τεχνικές μοριακής βιολογίας. Ο όρος περιλαμβάνει όλες τις τεχνικές με τις οποίες ένα μόριο νουκλεϊκού οξέος μπορεί να εισαχθεί σε ένα τέτοιο κύτταρο, συμπεριλαμβανομένης της επιμόλυνσης με ιικούς φορείς, του μετασχηματισμού με τους φορείς πλασμιδίων και την εισαγωγή γυμνού DNA με ηλεκτροπόρωση, λιποπροστασία και επιτάχυνση σωματιδίων.

Φορέας: Ένα μόριο νουκλεϊκού οξέος όπως εισάγεται σε ένα κύτταρο ξενιστή, δημιουργώντας έτσι ένα μετασχηματισμένο κύτταρο ξενιστή. Ένας φορέας μπορεί να περιλαμβάνει αλληλουχίες νουκλεϊκών οξέων που του επιτρέπουν να αντιγραφεί σε ένα κύτταρο ξενιστή, όπως μια αρχή αντιγραφής. Ένας φορέας μπορεί επίσης να περιλαμβάνει ένα ή περισσότερα επιλεγόμενα γονίδια δείκτη και άλλα γενετικά στοιχεία γνωστά στην τεχνική.

Ιός: Μικροσκοπικός μολυσματικός οργανισμός που αναπαράγεται μέσα στα ζωντανά κύτταρα. Ένας ιός τυπικά αποτελείται ουσιαστικά από έναν πυρήνα ενός μόνο νουκλεϊκού οξέος που περιβάλλεται από μια πρωτεϊνική επικάλυψη και έχει την ικανότητα να αναπαράγεται μόνο μέσα σε ένα ζωντανό κύτταρο. «Ιϊκή αντιγραφή» είναι η παραγωγή πρόσθετου ιού με την εμφάνιση τουλάχιστον ενός ιικού κύκλου ζωής. Ένας ιός μπορεί να ανατρέψει τις φυσιολογικές λειτουργίες των κυττάρων -ξενιστών, με αποτέλεσμα το κύτταρο να συμπεριφέρεται με τρόπο που καθορίζεται από τον ιό. Για παράδειγμα, μια ιογενής λοίμωξη μπορεί να έχει ως αποτέλεσμα ένα κύτταρο να παράγει μια κυτοκίνη ή να ανταποκρίνεται σε μια κυτοκίνη, όταν το μη μολυσμένο κύτταρο δεν το κάνει κανονικά.

Οι «κοροναϊοί» είναι μεγάλοι, τυλιγμένοι, ιοί RNA που προκαλούν αναπνευστικές και εντερικές ασθένειες σε ανθρώπους και άλλα ζώα. Τα γονιδιώματα του κορωνοϊού είναι μη τμηματοποιημένο, μονόκλωνο, RNA θετικής αίσθησης, μήκους περίπου 27-31 kb. Τα γονιδιώματα έχουν 5 ′ μεθυλιωμένο πώμα και 3 tail ουρά πολυ-Α και λειτουργούν άμεσα ως mRNA. Η είσοδος του κυττάρου ξενιστή συμβαίνει μέσω ενδοκυττάρωσης και σύντηξης μεμβράνης και η αντιγραφή συμβαίνει στο κυτταρόπλασμα. Αρχικά, το 5 ′ 20 kb του γονιδιώματος θετικής αίσθησης μεταφράζεται για να παράγει μια ιική πολυμεράση, η οποία στη συνέχεια παράγει ένα σκέλος αρνητικής αίσθησης πλήρους μήκους που χρησιμοποιείται ως πρότυπο για την παραγωγή υπογονιδιωματικού mRNA ως «ένθετου συνόλου» μεταγραφών. Η συναρμολόγηση πραγματοποιείται με εκκόλαψη στη συσκευή golgi και τα σωματίδια μεταφέρονται στην επιφάνεια του κυττάρου και απελευθερώνονται.

III. Επισκόπηση πολλών υλοποιήσεων

Ένας νεοαπομονωμένος ανθρώπινος κορωνοϊός (SARS-CoV) αποκαλύπτεται εδώ. Ολόκληρη η γονιδιωματική αλληλουχία νουκλεϊκών οξέων αυτού του ιού παρέχεται επίσης εδώ. Αποκαλύπτονται επίσης οι αλληλουχίες νουκλεϊκών οξέων των SARS-CoV ORF και οι πολυπεπτιδικές αλληλουχίες που κωδικοποιούνται από αυτά τα ORF. Αποκαλύπτονται επίσης φαρμακευτικές και ανοσοδιεγερτικές συνθέσεις που περιλαμβάνουν ένα ή περισσότερα ιικά νουκλεϊκά οξέα SARS-CoV, πολυπεπτίδια που κωδικοποιούνται από αυτά τα ιικά νουκλεϊκά οξέα και αντισώματα που συνδέονται με ένα πολυπεπτίδιο SARS-CoV ή θραύσμα πολυπεπτιδίου SARS-CoV.

Σε μία εφαρμογή, παρέχεται μια μέθοδος για την ανίχνευση της παρουσίας SARS-CoV σε ένα δείγμα. Αυτή η μέθοδος περιλαμβάνει την επαφή του δείγματος με ένα ζεύγος εκκινητών νουκλεϊνικού οξέος που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV, όπου τουλάχιστον ένας εκκινητής είναι 5′-άκρων επισημασμένος με μια βαφή αναφοράς, ενισχύοντας το νουκλεϊκό οξύ SARS-CoV ή ένα θραύσμα του από το δείγμα που χρησιμοποιεί το ζεύγος εκκινητών νουκλεϊνικού οξέος, ηλεκτροφόρηση των ενισχυμένων προϊόντων και ανίχνευση της χρωστικής αναφοράς ανταποκρινόμενου στο άκρο 5′, ανιχνεύοντας έτσι ένα SARS-CoV. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, η ενίσχυση χρησιμοποιεί RT-PCR. Σε ένα περαιτέρω ειδικό παράδειγμα της παρεχόμενης μεθόδου, τουλάχιστον ένας από τους εκκινητές νουκλεϊκών οξέων που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV περιλαμβάνει μια αλληλουχία όπως εκτίθεται σε οποιοδήποτε από τα SEQ ID ΝΟ: 13-15.

Σε ένα άλλο παράδειγμα της παρεχόμενης μεθόδου, η ανίχνευση της παρουσίας του SARS-CoV σε ένα δείγμα περιλαμβάνει την επαφή του δείγματος με ένα ζεύγος εκκινητών νουκλεϊκών οξέων που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV, ενισχύοντας το νουκλεϊκό οξύ SARS-CoV ή ένα θραύσμα του από το δείγμα που χρησιμοποιεί το ζεύγος εκκινητών νουκλεϊκών οξέων, προσθέτοντας στο ενισχυμένο νουκλεϊκό οξύ SARS-CoV ή το τεμάχιο αυτού έναν ανιχνευτή TaqMan SARS-CoV που υβριδοποιείται στο νουκλεϊνικό οξύ SARS-CoV, όπου ο ανιχνευτής TaqMan SARS-CoV επισημαίνεται με μια βαφή 5′-ρεπόρτερ και μια βαφή 3′-σβέσης, εκτελώντας έναν ή περισσότερους επιπλέον γύρους ενίσχυσης και ανίχνευση φθορισμού της βαφής 5′-ρεπόρτερ, ανιχνεύοντας έτσι ένα SARS-CoV. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, η ενίσχυση χρησιμοποιεί RT-PCR. Σε ένα περαιτέρω ειδικό παράδειγμα της παρεχόμενης μεθόδου,

Σε μια άλλη εφαρμογή, παρέχεται μια μέθοδος για την ανίχνευση ενός SARS-CoV σε ένα βιολογικό δείγμα που περιέχει αντισώματα. Αυτή η μέθοδος περιλαμβάνει την επαφή του βιολογικού δείγματος με ένα αντιγόνο ειδικό για τον SARS-CoV, όπου το αντιγόνο περιλαμβάνει έναν οργανισμό SARS-CoV και τον προσδιορισμό του αν συμβαίνει αντίδραση δέσμευσης μεταξύ του ειδικού αντιγόνου SARS-CoV και ενός αντισώματος στο βιολογικό δείγμα, εάν υπάρχει παρούσα, ανιχνεύοντας έτσι τον SARS-CoV.

Σε μια περαιτέρω εφαρμογή, παρέχεται μια μέθοδος για την ανίχνευση ενός SARS-CoV σε ένα βιολογικό δείγμα που περιέχει πολυπεπτίδια και/ή θραύσματα αυτών. Αυτή η μέθοδος περιλαμβάνει την επαφή του βιολογικού δείγματος με ένα αντίσωμα ειδικό για τον SARS-CoV και τον προσδιορισμό του αν συμβαίνει αντίδραση δέσμευσης μεταξύ του ειδικού αντισώματος SARS-CoV και ενός πολυπεπτιδίου SARS-CoV ή θραύσματός του στο βιολογικό δείγμα εάν υπάρχει, ανιχνεύοντας έτσι SARS-CoV. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, ο προσδιορισμός του αν συμβαίνει αντίδραση δέσμευσης μεταξύ του ειδικού αντισώματος SARS-CoV και ενός πολυπεπτιδίου SARS-CoV ή θραύσματος του πραγματοποιείται επί τόπου ή σε δείγμα ιστού. Σε ένα περαιτέρω ειδικό παράδειγμα, ο προσδιορισμός του αν συμβαίνει αντίδραση σύνδεσης μεταξύ του ειδικού αντισώματος SARS-CoV και ενός πολυπεπτιδίου SARS-CoV ή θραύσματος αυτού περιλαμβάνει ανοσοϊστοχημική δοκιμασία.

Μια πρόσθετη ενσωμάτωση περιλαμβάνει ένα κιτ για ανίχνευση ενός SARS-CoV σε ένα δείγμα, που περιλαμβάνει ένα ζευγάρι εκκινητών νουκλεϊνικού οξέος που υβριδοποιούνται υπό αυστηρές συνθήκες σε ένα νουκλεϊκό οξύ SARS-CoV, όπου ένας εκκινητής είναι 5′-άκρης επισημασμένος με μια βαφή αναφοράς. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, τουλάχιστον ένας από τους εκκινητές νουκλεϊκών οξέων που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV περιλαμβάνει μια αλληλουχία όπως εκτίθεται σε οποιοδήποτε από τα SEQ ID ΝΟ: 13-15.

Ένα άλλο παράδειγμα του παρεχόμενου κιτ περιλαμβάνει ένα ζευγάρι εκκινητών νουκλεϊκών οξέων που υβριδοποιούνται υπό συνθήκες υψηλής αυστηρότητας σε ένα νουκλεϊκό οξύ SARS-CoV και έναν ανιχνευτή TaqMan SARS-CoV που υβριδοποιείται στο νουκλεϊκό οξύ SARS-CoV, όπου ο ανιχνευτής TaqMan SARS-CoV επισημαίνεται με μια βαφή 5′-ρεπόρτερ και μια βαφή 3′-σβέσης. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, τουλάχιστον ένας από τους εκκινητές νουκλεϊκών οξέων που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV και/ή ο ανιχνευτής TaqMan SARS-CoV που υβριδοποιείται στο νουκλεϊκό οξύ SARS-CoV περιλαμβάνει μια αλληλουχία όπως εκτίθεται σε οποιοδήποτε από τα SEQ ID NO: 16-33.

Αποκαλύπτεται επίσης εδώ μια σύνθεση που περιλαμβάνει έναν απομονωμένο οργανισμό SARS-CoV. Σε μία εφαρμογή, ο απομονωμένος οργανισμός SARS-CoV είναι ένας ανενεργός απομονωμένος οργανισμός SARS-CoV. Σε άλλη υλοποίηση, η σύνθεση περιλαμβάνει τουλάχιστον ένα συστατικό που επιλέγεται από την ομάδα που αποτελείται από φαρμακευτικά αποδεκτούς φορείς, πρόσθετα και συνδυασμούς δύο ή περισσοτέρων αυτών. Σε μια ακόμη υλοποίηση, η σύνθεση εισάγεται σε ένα υποκείμενο, προκαλώντας έτσι μια ανοσοαπόκριση έναντι ενός αντιγονικού επιτόπου SARS-CoV σε ένα άτομο.

  1. Αλληλουχίες νουκλεοτιδίων SARS-CoV και αμινοξέων

Η παρούσα αποκάλυψη παρέχει ένα απομονωμένο γονιδίωμα SARS-CoV, απομονωμένα πολυπεπτίδια SARS-CoV και απομονωμένα μόρια νουκλεϊνικού οξέος που κωδικοποιούν το ίδιο. Σε μία εφαρμογή, το απομονωμένο γονιδίωμα SARS-CoV έχει μια αλληλουχία όπως φαίνεται στην SEQ ID ΝΟ: 1 ή ισοδύναμο αυτού. Παρέχονται επίσης πολυνουκλεοτίδια που κωδικοποιούν ένα πολυπεπτίδιο SARS-CoV (κωδικοποιείται με ORF από το γονιδίωμα) και ονομάζονται μόρια νουκλεϊκού οξέος SARS-CoV. Αυτά τα μόρια νουκλεϊκού οξέος περιλαμβάνουν αλληλουχίες DNA, cDNA και RNA που κωδικοποιούν ένα πολυπεπτίδιο SARS-CoV. Ειδικά, μη περιοριστικά παραδείγματα μορίου νουκλεϊκού οξέος SARS-CoV που κωδικοποιεί ORF είναι νουκλεϊκό οξύ 265 προς νουκλεϊκό οξύ 13,398 της SEQ ID ΝΟ: 1 (κωδικοποιώντας SARS-CoV 1a, SEQ ID ΝΟ: 2), νουκλεϊκό οξύ 13,398 έως 21,482 της SEQ ID ΝΟ: 1 (κωδικοποίηση SARS-CoV 1b, SEQ ID ΝΟ: 3), νουκλεϊκό οξύ 21.492 έως 25.256 της SEQ ID ΝΟ: 1 (κωδικοποίηση SARS-CoV S,

Οι ολιγονουκλεοτιδικοί εκκινητές και οι ανιχνευτές που προέρχονται από το γονιδίωμα SARS-CoV (SEQ ID ΝΟ: 1) περιλαμβάνονται επίσης στο πλαίσιο της παρούσας αποκάλυψης. Τέτοιοι ολιγονουκλεοτιδικοί εκκινητές και ανιχνευτές μπορούν να περιλαμβάνουν μια αλληλουχία τουλάχιστον περίπου 15 διαδοχικών νουκλεοτιδίων της αλληλουχίας νουκλεϊκών οξέων SARS-CoV, όπως τουλάχιστον περίπου 20, 25, 30, 35, 40, 45, ή 50 ή περισσότερων διαδοχικών νουκλεοτιδίων. Αυτοί οι εκκινητές και οι ανιχνευτές μπορούν να ληφθούν από οποιαδήποτε περιοχή του αποκαλυπτόμενου γονιδιώματος SARS-CoV (SEQ ID ΝΟ: 1), συμπεριλαμβανομένων ιδιαίτερα από οποιοδήποτε από τα ORF που αποκαλύπτονται εδώ. Ειδικά, μη περιοριστικά παραδείγματα ολιγονουκλεοτιδικών εκκινητών που προέρχονται από το γονιδίωμα SARS-CoV (SEQ ID ΝΟ: 1) περιλαμβάνουν: Cor-p-F2 (SEQ ID NO: 13), Cor-p-F3 (SEQ ID NO: 14) , Cor-p-R1 (SEQ ID NO: 15), SARS1-F (SEQ ID NO: 16), SARS1 — R (SEQ ID NO: 17), SARS2-F (SEQ ID NO: 19), SARS2 — R (SEQ ID NO: 20), SARS3-F (SEQ ID NO: 22), SARS3 — R (SEQ ID NO: 23), N3-F (SEQ ID NO: 25), N3-R (SEQ ID NO: 26), 3′NTR-F ( SEQ ID ΝΟ: 28), 3′NTR-R (SEQ ID ΝΟ: 29), MF (SEQ ID ΝΟ: 31), και MR (SEQ ID ΝΟ: 32). Συγκεκριμένα, μη περιοριστικά παραδείγματα ολιγονουκλεοτιδικών ανιχνευτών που προέρχονται από το γονιδίωμα SARS-CoV (SEQ ID ΝΟ: 1) περιλαμβάνουν: SARS1-P (SEQ ID NO: 18), SARS2-P (SEQ ID NO: 21), SARS3-P (SEQ ID ΝΟ: 24), N3-P (SEQ ID ΝΟ: 27), 3′NTR-P (SEQ ID ΝΟ: 30), και MP (SEQ ID ΝΟ: 33).

Μόρια νουκλεϊνικού οξέος που κωδικοποιούν ένα πολυπεπτίδιο SARS-CoV μπορούν να συνδεθούν λειτουργικά με ρυθμιστικές αλληλουχίες ή στοιχεία. Οι ρυθμιστικές ακολουθίες ή στοιχεία περιλαμβάνουν, αλλά δεν περιορίζονται σε υποκινητές, ενισχυτές, τερματιστές μεταγραφής, κωδικόνιο έναρξης (για παράδειγμα, ATG), κωδικόνια διακοπής και παρόμοια.

Επιπλέον, μόρια νουκλεϊκού οξέος που κωδικοποιούν ένα πολυπεπτίδιο SARS-CoV μπορούν να εισαχθούν σε έναν φορέα έκφρασης. Ειδικά, μη περιοριστικά παραδείγματα φορέων περιλαμβάνουν, πλασμίδια, βακτηριοφάγους, κοσμίδια, ζωικούς ιούς και τεχνητά χρωμοσώματα ζύμης (YACs) (Burke et al., Science 236: 806-12, 1987). Τέτοιοι φορείς μπορούν στη συνέχεια να εισαχθούν σε μια ποικιλία ξενιστών που περιλαμβάνουν σωματικά κύτταρα και απλούς ή πολύπλοκους οργανισμούς, όπως βακτήρια, μύκητες (Timberlake and Marshall, Science 244: 1313-17, 1989), ασπόνδυλα, φυτά (Gasser et al., Plant Cell 1: 15-24, 1989), και ζώα (Pursel et al., Science 244: 1281-88, 1989).

Ο μετασχηματισμός ενός κυττάρου ξενιστή με έναν φορέα έκφρασης που φέρει ένα μόριο νουκλεϊκού οξέος που κωδικοποιεί ένα πολυπεπτίδιο SARS-CoV μπορεί να πραγματοποιηθεί με συμβατικές τεχνικές, όπως είναι καλά γνωστές στους έμπειρους στην τέχνη. Υπό τύπον παραδείγματος, όπου ο ξενιστής είναι προκαρυωτικός, όπως Ε coli , τα ικανά κύτταρα που είναι ικανά να DNA πρόσληψης μπορούν να παρασκευαστούν από κύτταρα που συγκομίζονται μετά από εκθετική φάση ανάπτυξης και στη συνέχεια κατεργάζεται με το CaCl 2 μέθοδο χρησιμοποιώντας διαδικασίες καλά γνωστές στην τέχνη Το Εναλλακτικά, MgCl 2 ή ΚοΟΙ μπορούν να χρησιμοποιηθούν. Ο μετασχηματισμός μπορεί επίσης να πραγματοποιηθεί μετά τον σχηματισμό ενός πρωτοπλάστη του κυττάρου ξενιστή εάν είναι επιθυμητό ή με ηλεκτροπόρωση.

Όταν ο ξενιστής είναι ευκαρυώτης, μπορούν να χρησιμοποιηθούν μέθοδοι επιμόλυνσης του DNA, όπως συν -κατακρημνισμένα φωσφορικά ασβέστιο, συμβατικές μηχανικές διαδικασίες όπως μικροέγχυση, ηλεκτροπόρωση, εισαγωγή πλασμιδίου εγκλωβισμένου σε λιποσώματα ή φορείς ιών. Τα ευκαρυωτικά κύτταρα μπορούν επίσης να μετασχηματιστούν με μόρια νουκλεϊκού οξέος SARS-CoV και ένα δεύτερο ξένο μόριο DNA που κωδικοποιεί έναν επιλέξιμο φαινότυπο, όπως το γονίδιο κινάσης θυμιδίνης απλού έρπητα. Μια άλλη μέθοδος είναι η χρήση ευκαρυωτικού ιικού φορέα, όπως ο ιός simian 40 ή ο ιός θηλωμάτων βοοειδών, για να μολυνθούν παροδικά ή να μετασχηματιστούν ευκαρυωτικά κύτταρα και να εκφραστεί η πρωτεΐνη (βλέπε, για παράδειγμα, Eukaryotic Viral Vectors , Cold Spring Harbor Laboratory, Gluzman ed., 1982).

Τα πολυπεπτίδια SARS-CoV αυτής της αποκάλυψης περιλαμβάνουν πρωτεΐνες που κωδικοποιούνται από οποιοδήποτε από τα ORF που αποκαλύπτονται εδώ, και ισοδύναμα αυτών. Συγκεκριμένα, μη περιοριστικά παραδείγματα πρωτεϊνών SARS-CoV παρέχονται στις SEQ ID ΝΟ: 2-12. Προβλέπονται επίσης πρωτεΐνες σύντηξης που περιλαμβάνουν μια ετερόλογη αλληλουχία αμινοξέων χημικά συνδεδεμένη με ένα πολυπεπτίδιο SARS-CoV. Οι υποδειγματικές ετερόλογες αλληλουχίες περιλαμβάνουν σύντομες ετικέτες αλληλουχίας αμινοξέων (όπως έξι υπολείμματα ιστιδίνης), καθώς και μια σύντηξη άλλων πρωτεϊνών (όπως συντήξεις c-myc ή πράσινης φθορισμού πρωτεΐνης). Οι επίτοποι των πρωτεϊνών SARS-CoV, που αναγνωρίζονται από ένα αντίσωμα ή που δεσμεύουν το κύριο σύμπλεγμα ιστοσυμβατότητας, και μπορούν να χρησιμοποιηθούν για να προκαλέσουν μια ειδική για τον SARS-CoV ανοσοαπόκριση, περιλαμβάνονται επίσης σε αυτήν την αποκάλυψη.

Μέθοδοι για την έκφραση μεγάλων ποσοτήτων πρωτεΐνης από ένα κλωνοποιημένο γονίδιο που εισάγεται στο Ε. Coli μπορούν να χρησιμοποιηθούν για τον καθαρισμό και τη λειτουργική ανάλυση πρωτεϊνών. Για παράδειγμα, πρωτεΐνες σύντηξης που αποτελούνται από αμινοτελικά πεπτίδια κωδικοποιημένα από ένα τμήμα του γονιδίου E.coli lacZ ή trpE που συνδέεται με πρωτεΐνες SARS-CoV μπορούν να χρησιμοποιηθούν για την παρασκευή πολυκλωνικών και μονοκλωνικών αντισωμάτων έναντι αυτών των πρωτεϊνών.

Άθικτη φυσική πρωτεΐνη μπορεί επίσης να παραχθεί σε Ε. Coli σε μεγάλες ποσότητες για λειτουργικές μελέτες. Μέθοδοι και φορείς πλασμιδίου για την παραγωγή πρωτεϊνών σύντηξης και άθικτων φυσικών πρωτεϊνών σε βακτήρια περιγράφονται από τους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 ndεκδ., τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ΝΥ, 1989. Τέτοιες πρωτεΐνες σύντηξης μπορεί να παρασκευάζονται σε μεγάλες ποσότητες, είναι εύκολο να καθαριστούν και μπορούν να χρησιμοποιηθούν για να προκαλέσουν απόκριση αντισώματος. Οι φυσικές πρωτεΐνες μπορούν να παραχθούν σε βακτήρια τοποθετώντας έναν ισχυρό, ρυθμιζόμενο υποκινητή και μια αποτελεσματική θέση σύνδεσης με ριβοσώματα αντίθετα από το κλωνοποιημένο γονίδιο. Εάν παράγονται χαμηλά επίπεδα πρωτεΐνης, μπορεί να ληφθούν πρόσθετα βήματα για την αύξηση της παραγωγής πρωτεϊνών. εάν παράγονται υψηλά επίπεδα πρωτεΐνης, ο καθαρισμός είναι σχετικά εύκολος. Οι κατάλληλες μέθοδοι παρουσιάζονται από τους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 ndεκδ., τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ΝΥ, 1989, και είναι πολύ γνωστά στην τέχνη. Συχνά, οι πρωτεΐνες που εκφράζονται σε υψηλά επίπεδα βρίσκονται σε αδιάλυτα σώματα εγκλεισμού. Οι μέθοδοι για την εξαγωγή πρωτεϊνών από αυτά τα συσσωματώματα περιγράφονται από τους Sambrook et al. (ed.), Molecular Cloning: Α Laboratory Manual, 2 nd ed., Τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

Η απομόνωση και ο καθαρισμός των ανασυνδυαστικά εκφρασμένων πρωτεϊνών μπορεί να πραγματοποιηθεί με συμβατικά μέσα, συμπεριλαμβανομένης της προπαρασκευαστικής χρωματογραφίας και των ανοσολογικών διαχωρισμών. Επιπροσθέτως, οι πρωτεΐνες μπορούν να συντεθούν χημικά με οποιαδήποτε από τις χειροκίνητες ή αυτοματοποιημένες μεθόδους σύνθεσης που είναι γνωστές στην τεχνική.

  1. Ειδικοί δεσμευτικοί παράγοντες

Η αποκάλυψη παρέχει ειδικούς συνδετικούς παράγοντες που συνδέονται με πολυπεπτίδια SARS-CoV που αποκαλύπτονται εδώ. Ο συνδετικός παράγοντας μπορεί να είναι χρήσιμος για τον καθαρισμό και την ανίχνευση των πολυπεπτιδίων, καθώς και για την ανίχνευση και διάγνωση του SARS-CoV. Παραδείγματα των συνδετικών παραγόντων είναι ένα πολυκλωνικό ή μονοκλωνικό αντίσωμα, και θραύσματα αυτού, που συνδέονται με οποιοδήποτε από τα πολυπεπτίδια SARS-CoV που αποκαλύπτονται εδώ.

Μονοκλωνικά ή πολυκλωνικά αντισώματα μπορούν να ανυψωθούν για να αναγνωρίσουν ένα πολυπεπτίδιο SARS-CoV που περιγράφεται εδώ, ή ένα θραύσμα ή παραλλαγή αυτού. Κατά βέλτιστο τρόπο, τα αντισώματα που δημιουργούνται έναντι αυτών των πολυπεπτιδίων θα ανιχνεύουν συγκεκριμένα το πολυπεπτίδιο με το οποίο δημιουργούνται τα αντισώματα. Δηλαδή, αντισώματα που δημιουργούνται εναντίον ενός συγκεκριμένου πολυπεπτιδίου SARS-CoV θα αναγνωρίζουν και θα δεσμεύουν αυτό το πολυπεπτίδιο και δεν θα αναγνωρίζουν ουσιαστικά ούτε θα συνδέονται με άλλα πολυπεπτίδια ή αντιγόνα. Ο προσδιορισμός ότι ένα αντίσωμα συνδέεται ειδικά με ένα πολυπεπτίδιο στόχο γίνεται με οποιαδήποτε από έναν αριθμό τυπικών μεθόδων ανοσοπροσδιορισμού. για παράδειγμα, η τεχνική Western blotting (Sambrook et al (ed),.. Molecular Cloning: Α Laboratory Manual, 2 ndεκδ., τομ. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ΝΥ, 1989).

Ουσιαστικά καθαρά αντισώματα ανασυνδυασμένου πολυπεπτιδίου SARS-CoV κατάλληλα για χρήση ως ανοσογόνο μπορούν να απομονωθούν από τα μετασχηματισμένα κύτταρα που περιγράφηκαν παραπάνω, χρησιμοποιώντας μεθόδους πασίγνωστες στην τεχνική. Στη συνέχεια μπορούν να παρασκευαστούν μονοκλωνικά ή πολυκλωνικά αντισώματα στα αντιγόνα.

Μονοκλωνικά αντισώματα στα πολυπεπτίδια μπορούν να παρασκευαστούν από υβριδώματα ποντικών σύμφωνα με την κλασική μέθοδο των Kohler & Milstein ( Nature256: 495-97, 1975), ή μια παράγωγη μέθοδος αυτής. Εν συντομία, ένας ποντικός εμβολιάζεται επανειλημμένα με μερικά μικρογραμμάρια του επιλεγμένου ανοσογόνου πρωτεΐνης (για παράδειγμα, ένα πολυπεπτίδιο που περιλαμβάνει τουλάχιστον έναν επιτόπιο ειδικό για τον SARS-CoV, ένα τμήμα πολυπεπτιδίου που περιλαμβάνει τουλάχιστον έναν επιτόπιο ειδικό για SARS-CoV, ή ένα συνθετικό πεπτίδιο που περιλαμβάνει τουλάχιστον έναν επιτόπιο ειδικό για τον SARS-CoV) σε διάστημα μερικών εβδομάδων. Το ποντίκι θυσιάζεται και τα κύτταρα της σπλήνας που παράγουν αντίσωμα απομονώνονται. Τα κύτταρα της σπλήνας συντήκονται μέσω πολυαιθυλενογλυκόλης με κύτταρα μυελώματος ποντικού και τα περίσσεια μη συντηγμένων κυττάρων καταστρέφονται από την ανάπτυξη του συστήματος σε εκλεκτικά μέσα που περιλαμβάνουν αμινοπτερίνη (μέσα HAT). Τα επιτυχώς συντηγμένα κύτταρα αραιώνονται και δείγματα της αραίωσης τοποθετούνται σε φρεάτια πλάκας μικροτίτλου όπου συνεχίζεται η ανάπτυξη της καλλιέργειας.Meth. Enzymol., 70: 419-39, 1980), ή μια παράγωγη μέθοδος αυτού. Επιλεγμένοι θετικοί κλώνοι μπορούν να επεκταθούν και το προϊόν των μονοκλωνικών αντισωμάτων τους να συλλεχθεί για χρήση. Λεπτομερείς διαδικασίες για παραγωγή μονοκλωνικών αντισωμάτων περιγράφονται στο Harlow and Lane, Using Antibodies: A Laboratory Manual , CSHL, New York, 1999.

Πολυκλωνικά αντισώματα που περιέχουν αντισώματα μπορούν να παρασκευαστούν με ανοσοποίηση κατάλληλων ζώων με πολυπεπτίδιο που περιλαμβάνει τουλάχιστον έναν επιτόπιο ειδικό για SARS-CoV, τμήμα πολυπεπτιδίου που περιλαμβάνει τουλάχιστον έναν επιτόπιο ειδικό για SARS-CoV ή συνθετικό πεπτίδιο που περιλαμβάνει τουλάχιστον ένα SARS -Ειδικός για τον CoV επίτοπος, ο οποίος μπορεί να μην τροποποιηθεί ή να τροποποιηθεί, για ενίσχυση της ανοσογονικότητας.

Η αποτελεσματική παραγωγή αντισωμάτων (είτε μονοκλωνικά είτε πολυκλωνικά) επηρεάζεται από πολλούς παράγοντες που σχετίζονται τόσο με το αντιγόνο όσο και με το είδος ξενιστή. Για παράδειγμα, τα μικρά μόρια τείνουν να είναι λιγότερο ανοσογόνα από άλλα και μπορεί να απαιτούν τη χρήση φορέων και πρόσθετων. Επίσης, τα ζώα ξενιστές ποικίλλουν ανάλογα με τη θέση των εμβολιασμών και τη δόση, με ανεπαρκείς ή υπερβολικές δόσεις αντιγόνου με αποτέλεσμα αντιορούς χαμηλού τίτλου. Μικρές δόσεις (επίπεδο ng) αντιγόνου που χορηγούνται σε πολλαπλές ενδοδερμικές θέσεις φαίνεται να είναι οι πιο αξιόπιστες. Ένα αποτελεσματικό πρωτόκολλο ανοσοποίησης για κουνέλια μπορεί να βρεθεί στους Vaitukaitis et al. ( J. Clin. Endocrinol. Metab., 33: 988-91, 1971).

Ενισχυτικές ενέσεις μπορούν να γίνουν σε τακτά χρονικά διαστήματα και ο αντιορός συλλέγεται όταν ο τίτλος του αντισώματος αυτού, όπως προσδιορίζεται ημι-ποσοτικά, για παράδειγμα, με διπλή ανοσοδιάχυση σε άγαρ έναντι γνωστών συγκεντρώσεων του αντιγόνου, αρχίζει να πέφτει. Βλέπε, για παράδειγμα, Ouchterlony et al., Handbook of Experimental Immunology , Wier, D. (επιμ.), Κεφάλαιο 19, Blackwell, 1973. Μια συγκέντρωση οροπεδίου αντισώματος είναι συνήθως στην περιοχή 0,1 έως 0,2 mg/ml ορού (περίπου 12 μΜ). Η συγγένεια των αντιορών για το αντιγόνο προσδιορίζεται με την προετοιμασία καμπυλών ανταγωνιστικής σύνδεσης, όπως περιγράφεται, για παράδειγμα, από τον Fisher ( Manual of Clinical Immunology , Ch. 42, 1980).

Τα θραύσματα αντισωμάτων μπορούν να χρησιμοποιηθούν στη θέση ολόκληρων αντισωμάτων και μπορούν να εκφραστούν εύκολα σε προκαρυωτικά κύτταρα ξενιστές. Οι μέθοδοι παρασκευής και χρήσης ανοσολογικά αποτελεσματικών τμημάτων μονοκλωνικών αντισωμάτων, που αναφέρονται επίσης ως «θραύσματα αντισωμάτων», είναι πολύ γνωστές και περιλαμβάνουν αυτές που περιγράφονται στο Better & Horowitz, Methods Enzymol. 178: 476-96, 1989; Glockshuber et al., Biochemistry29: 1362-67, 1990; και US Pat. 5,648,237 (Έκφραση θραυσμάτων λειτουργικών αντισωμάτων). 4,946,778 (Μόνα δεσμευτικά μόρια πολυπεπτιδικής αλυσίδας); και 5,455,030 (Ανοσοθεραπεία με χρήση μορίων σύνδεσης πολυπεπτιδίων μονής αλυσίδας), και αναφορές που αναφέρονται εκεί. Οι συνθήκες κατά τις οποίες μπορεί να σχηματιστεί ένα σύμπλεγμα πολυπεπτιδίου/συνδετικού παράγοντα, καθώς και δοκιμασίες για την ανίχνευση του σχηματισμού ενός συμπλόκου πολυπεπτιδίου/παράγοντα σύνδεσης και τον ποσοτικό προσδιορισμό των συνάφειας σύνδεσης του συνδετικού παράγοντα και του πολυπεπτιδίου, είναι τυπικές στην τεχνική. Τέτοιες δοκιμασίες μπορούν να περιλαμβάνουν, χωρίς να περιορίζονται σε αυτές, στυπώσεις Western, ανοσοκαταβύθιση, ανοσοφθορισμό, ανοσοκυτταροχημεία, ανοσοϊστοχημεία, ταξινόμηση κυττάρων με ενεργοποίηση φθορισμού (FACS), υβριδισμό φθορισμού επί τόπου (FISH), ανοσομαγνητικούς προσδιορισμούς, ELISA, ELISPOT (Coligan et al.,Current Protocols in Immunology , Wiley, NY, 1995), δοκιμασίες συγκόλλησης, δοκιμασίες κροκίδωσης, κυτταρική περιστροφή, και τα παρόμοια, όπως είναι καλά γνωστά σε έναν έμπειρο στην τέχνη.

Οι συνδετικοί παράγοντες αυτής της αποκάλυψης μπορούν να συνδεθούν με ένα υπόστρωμα (για παράδειγμα, σφαιρίδια, σωλήνες, πλάκες, πλάκες, φύλλα νιτροκυτταρίνης και τα παρόμοια) ή να συζευχθούν με ανιχνεύσιμο τμήμα, ή να δεσμευτούν και να συζευχθούν αμφότερα. Οι ανιχνεύσιμες ομάδες που προβλέπονται για την παρούσα αποκάλυψη μπορούν να περιλαμβάνουν, αλλά δεν περιορίζονται σε αυτές, ένα ανοσοφθορίζον τμήμα (για παράδειγμα, φλουορεσκεΐνη, ροδαμίνη), ένα ραδιενεργό τμήμα (για παράδειγμα, 32 Ρ, 125 Ι, 35 S), ένα ενζυμικό τμήμα ( για παράδειγμα, υπεροξειδάση χρένου, αλκαλική φωσφατάση), ένα τμήμα κολλοειδούς χρυσού και ένα τμήμα βιοτίνης. Τέτοιες τεχνικές σύζευξης είναι τυπικές στην τεχνική (για παράδειγμα, βλ. Harlow and Lane, Using Antibodies: A Laboratory Manual , CSHL, New York, 1999 · Yang et al., Nature,382:319-24, 1996).

  1. Ανίχνευση και διάγνωση του SARS-CoV

  2. Μέθοδοι ανίχνευσης και διάγνωσης με βάση το νουκλεϊνικό οξύ

Μια σημαντική εφαρμογή των πληροφοριών αλληλουχίας SARS-CoV που παρουσιάζονται εδώ είναι στον τομέα ανίχνευσης και διαγνωστικού ελέγχου για μόλυνση SARS-CoV. Μέθοδοι για την εξέταση ενός υποκειμένου για τον προσδιορισμό του εάν το άτομο έχει μολυνθεί ή είναι επί του παρόντος μολυσμένο με SARS-CoV αποκαλύπτονται εδώ.

Μία τέτοια μέθοδος περιλαμβάνει την παροχή ενός δείγματος, το οποίο δείγμα περιλαμβάνει ένα νουκλεϊκό οξύ όπως το DNA ή το RNA, και την παροχή μιας δοκιμασίας για την ανίχνευση στο δείγμα της παρουσίας ενός μορίου νουκλεϊκού οξέος SARS-CoV. Τα κατάλληλα δείγματα περιλαμβάνουν όλα τα βιολογικά δείγματα που είναι χρήσιμα για την ανίχνευση ιογενούς λοίμωξης σε άτομα, συμπεριλαμβανομένων, αλλά χωρίς περιορισμό, κυττάρων, ιστών (για παράδειγμα πνεύμονα και νεφρών), σωματικά υγρά (για παράδειγμα, αίμα, ορό, ούρα, σάλιο, πτύελα, και εγκεφαλονωτιαίο υγρό), αναρροφήσεις μυελού των οστών, BAL και στοματοφαρυγγικό πλύσιμο. Πρόσθετα κατάλληλα δείγματα περιλαμβάνουν όλα τα περιβαλλοντικά δείγματα χρήσιμα για την ανίχνευση της ιογενούς παρουσίας στο περιβάλλον, συμπεριλαμβανομένου, αλλά χωρίς περιορισμό, ενός δείγματος που λαμβάνεται από άψυχα αντικείμενα ή δεξαμενές σε εσωτερικό ή εξωτερικό περιβάλλον.

Σε μία εφαρμογή, η ανίχνευση στο δείγμα της παρουσίας ενός μορίου νουκλεϊκού οξέος SARS-CoV περιλαμβάνει την ενίσχυση μιας αλληλουχίας νουκλεϊκού οξέος SARS-CoV (ή ενός τεμαχίου αυτού). Μπορεί να χρησιμοποιηθεί οποιαδήποτε μέθοδος ενίσχυσης νουκλεϊκού οξέος. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, η PCR χρησιμοποιείται για την ενίσχυση της αλληλουχίας (των) νουκλεϊκών οξέων SARS-CoV. Σε ένα άλλο μη περιοριστικό παράδειγμα, η RT-PCR μπορεί να χρησιμοποιηθεί για την ενίσχυση των αλληλουχιών νουκλεϊκών οξέων SARS-CoV. Σε ένα επιπλέον μη περιοριστικό παράδειγμα, η μεσολάβηση της μεταγραφής μπορεί να χρησιμοποιηθεί για την ενίσχυση των αλληλουχιών νουκλεϊκών οξέων SARS-CoV.

Σε ορισμένες εφαρμογές, ένα ζεύγος ειδικών SARS-CoV εκκινητών χρησιμοποιείται στην αντίδραση ενίσχυσης. Ένας ή και οι δύο εκκινητές μπορούν να επισημανθούν με άκρο (για παράδειγμα, ραδιοεπισημασμένοι, φθορισμένοι ή βιοτινυλιωμένοι). Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, τουλάχιστον ένας από τους εκκινητές φέρει 5-άκρη επισημασμένη με τη βαφή αναφοράς 6-καρβοξυφθορεσκεΐνης (6-FAM). Το ζεύγος εκκινητών περιλαμβάνει έναν εκκινητή ανάντη (ο οποίος συνδέεται 5 ′ με το κατάντη αστάρι) και έναν κατάντη εκκινητή (ο οποίος συνδέει 3 ′ με τον εκκινητή ανάντη). Σε μία εφαρμογή, επισημαίνεται είτε το ανάντη αστάρι είτε το κατάντη αστάρι. Ειδικά, μη περιοριστικά παραδείγματα εκκινητών ειδικών για τον SARS-CoV περιλαμβάνουν, αλλά δεν περιορίζονται σε αυτά: Cor-p-F2 (SEQ ID NO: 13), Cor-p-F3 (SEQ ID NO: 14), Cor-p -R1 (SEQ ID NO: 15), SARS1-F (SEQ ID NO: 16), SARS1-R (SEQ ID NO: 17), SARS2-F (SEQ ID NO: 19), SARS2-R (SEQ ID NO : 20), SARS3-F (SEQ ID NO: 22), SARS3R (SEQ ID NO: 23), N3-F (SEQ ID NO: 25), N3-R (SEQ ID NO: 26), 3′NTR-F (SEQ ID ΝΟ: 28), 3′NTR-R (SEQ ID ΝΟ: 29), MF (SEQ ID ΝΟ: 31) και MR (SEQ ID ΝΟ: 32). Επιπρόσθετα ζεύγη εκκινητών μπορούν να δημιουργηθούν, για παράδειγμα, για την ενίσχυση οποιουδήποτε από τα ειδικά ORF που περιγράφονται εδώ, χρησιμοποιώντας γνωστές αρχές και μεθόδους σχεδιασμού αστάρι.

Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, η ηλεκτροφόρηση χρησιμοποιείται για τον εντοπισμό ενισχυμένων αλληλουχιών ειδικών για τον SARS-CoV. Η ηλεκτροφόρηση μπορεί να αυτοματοποιηθεί χρησιμοποιώντας πολλές μεθόδους γνωστές στην τεχνική. Σε μία εφαρμογή, χρησιμοποιείται ένας γενετικός αναλυτής, όπως ένας ABI 3100 Prism Genetic Analyzer (PE Applied Biosystems, Foster City, Calif.), Όπου οι ζώνες αναλύονται χρησιμοποιώντας το λογισμικό GeneScan (PE Applied Biosystems, Foster City, Calif.).

Σε ένα άλλο συγκεκριμένο, μη περιοριστικό παράδειγμα, χρησιμοποιούνται προσδιορισμοί υβριδισμού για την ανίχνευση ενισχυμένων ειδικών για SARS-CoV αλληλουχιών χρησιμοποιώντας διακριτικούς ολιγονουκλεοτιδικούς ανιχνευτές. Τέτοιοι ανιχνευτές περιλαμβάνουν ανιχνευτές «TaqMan». Οι ανιχνευτές TaqMan αποτελούνται από ένα ολιγονουκλεοτίδιο με ένα ρεπόρτερ στο άκρο 5′ και ένα σβέστη στο 3′ άκρο. Σε ένα συγκεκριμένο, μη περιοριστικό παράδειγμα, ο ρεπόρτερ είναι 6-FAM και το σβήσιμο είναι το Blackhole Quencher (Biosearch Tech., Inc., Novato, Calif.). Όταν ο ανιχνευτής είναι άθικτος, η εγγύτητα του ρεπόρτερ στο σβήσιμο έχει ως αποτέλεσμα την καταστολή του φθορισμού του ρεπόρτερ, κυρίως με μεταφορά ενέργειας συντονισμού φθορισμού. Εάν υπάρχει ο στόχος που μας ενδιαφέρει, ο ανιχνευτής TaqMan υβριδοποιείται ειδικά μεταξύ των εμπρόσθιων και των αντίστροφων θέσεων εκκινητή κατά τη διάρκεια του βήματος ανόπτησης PCR. Στη διαδικασία επιμήκυνσης PCR, η 5′-3 ′ νουκλεολυτική δραστηριότητα της πολυμεράσης Taq DNA διασπά τον υβριδοποιημένο ανιχνευτή μεταξύ του ανταποκριτή και του αποσβεστήρα. Τα θραύσματα του καθετήρα μετατοπίζονται στη συνέχεια από τον στόχο και ο πολυμερισμός του κλώνου συνεχίζεται. Η πολυμεράση Taq DNA δεν διασπά μη-υβριδοποιημένο ανιχνευτή και διασπά τον υβριδοποιημένο ανιχνευτή μόνο κατά τη διάρκεια του πολυμερισμού. Το άκρο 3′ του ανιχνευτή είναι φραγμένο για να αποτρέψει την επέκταση του αισθητήρα κατά τη διάρκεια της PCR. Η διάσπαση 5′-3 ′ νουκλεάσης του υβριδοποιημένου ανιχνευτή συμβαίνει σε κάθε κύκλο και δεν παρεμβαίνει στην εκθετική συσσώρευση του προϊόντος PCR. Η συσσώρευση προϊόντων PCR ανιχνεύεται άμεσα παρακολουθώντας την αύξηση του φθορισμού του ρεπόρτερ που απελευθερώνεται. Η αύξηση του σήματος φθορισμού ανιχνεύεται μόνο εάν η αλληλουχία -στόχος είναι συμπληρωματική του ανιχνευτή και ενισχύεται κατά τη διάρκεια της PCR. Επομένως, η μη ειδική ενίσχυση δεν ανιχνεύεται. Οι ειδικοί SARS-CoV ανιχνευτές TaqMan της παρούσας αποκάλυψης περιλαμβάνουν, αλλά δεν περιορίζονται σε: SARS1-P (SEQ ID NO: 18), SARS2-P (SEQ ID NO: 21), SARS3-P (SEQ ID NO: 24 ), N3-P (SEQ ID NO: 27), 3′NTR-P (SEQ ID NO: 30), και MP (SEQ ID NO: 33), και οι δοκιμασίες υβριδισμού περιλαμβάνουν, αλλά δεν περιορίζονται σε αυτές, μια πραγματική προσδιορισμός χρόνου RT-PCR.

Β. Πρωτεϊνικές μέθοδοι ανίχνευσης και διάγνωσης

Η παρούσα αποκάλυψη παρέχει περαιτέρω μεθόδους ανίχνευσης αντιγόνου SARS-CoV σε δείγμα και/ή διάγνωσης μόλυνσης SARS-CoV σε άτομο με ανίχνευση αντιγόνου SARS-CoV. Παραδείγματα τέτοιων μεθόδων περιλαμβάνουν την επαφή του δείγματος με ειδικό συνδετικό παράγοντα SARS-CoV υπό συνθήκες όπου μπορεί να σχηματιστεί σύμπλοκο αντιγόνου/παράγοντα σύνδεσης. και ανίχνευση σχηματισμού του συμπλέγματος, ανιχνεύοντας έτσι αντιγόνο SARS-CoV σε ένα δείγμα και/ή διάγνωση λοίμωξης SARS-CoV σε ένα άτομο. Θεωρείται ότι τουλάχιστον ορισμένα αντιγόνα θα βρίσκονται σε ένα άθικτο ιό SARS-CoV, θα είναι μια πρωτεΐνη κωδικοποιημένη με SARS-CoV που θα εμφανίζεται στην επιφάνεια ενός κυττάρου μολυσμένου με SARS-CoV που εκφράζει το αντιγόνο ή θα είναι ένα θραύσμα του αντιγόνο. Τα υπό εξέταση δείγματα που υπόκεινται σε ανάλυση με αυτές τις μεθόδους μπορούν να περιλαμβάνουν οποιοδήποτε δείγμα, όπως ένα κλινικό δείγμα,

Οι μέθοδοι για την ανίχνευση αντιγόνων σε ένα δείγμα συζητούνται, για παράδειγμα, στους Ausubel et al. Σύντομα Πρωτόκολλα στη Μοριακή Βιολογία, 4 ουεκδ., John Wiley & Sons, Inc., 1999. Οι ανοσοπροσδιορισμοί ενζύμων όπως IFA, ELISA και ανοσοκηλίδωση μπορούν εύκολα να προσαρμοστούν για να επιτευχθεί η ανίχνευση αντιγόνων SARS-CoV σύμφωνα με τις μεθόδους αυτής της αποκάλυψης. Μια μέθοδος ELISA αποτελεσματική για την ανίχνευση διαλυτών αντιγόνων SARS-CoV είναι η άμεση ανταγωνιστική ELISA. Αυτή η μέθοδος είναι πιο χρήσιμη όταν διατίθενται συγκεκριμένα αντισώματα SARS-CoV και καθαρισμένο αντιγόνο SARS-CoV. Εν συντομία: 1) επικαλύψτε ένα υπόστρωμα (για παράδειγμα, μια πλάκα μικροτιτλοδότησης) με ένα δείγμα που υποψιάζεται ότι περιέχει ένα αντιγόνο SARS-CoV. 2) επικοινωνήστε με το δεσμευμένο αντιγόνο SARS-CoV με ένα ειδικό αντίσωμα SARS-CoV συνδεδεμένο σε ανιχνεύσιμο τμήμα (για παράδειγμα, ένζυμο υπεροξειδάση χρένου ή ένζυμο αλκαλικής φωσφατάσης). 3) προσθέστε καθαρό αναστολέα αντιγόνο SARS-CoV. 4) επαφή των παραπάνω με το υπόστρωμα για το ένζυμο.

Μια πρόσθετη μέθοδος ELISA αποτελεσματική για την ανίχνευση διαλυτών αντιγόνων SARS-CoV είναι η ELISA αντισώματος-σάντουιτς. Αυτή η μέθοδος είναι συχνά πιο ευαίσθητη στην ανίχνευση αντιγόνου από την άμεση ανταγωνιστική μέθοδο ELISA. Εν συντομία: 1) επικαλύψτε ένα υπόστρωμα (για παράδειγμα, μια πλάκα μικροτιτλοδότησης) με ένα αντίσωμα ειδικό για τον SARS-CoV. 2) επικοινωνήστε με το δεσμευμένο αντίσωμα SARS-CoV με δείγμα ύποπτο ότι περιέχει αντιγόνο SARS-CoV. 3) επικοινωνήστε με τα παραπάνω με το αντίσωμα ειδικό για τον SARS-CoV συνδεδεμένο σε ανιχνεύσιμο τμήμα (για παράδειγμα, ένζυμο υπεροξειδάση χρένου ή ένζυμο αλκαλικής φωσφατάσης). 4) επαφή των παραπάνω με το υπόστρωμα για το ένζυμο. και 5) παρατηρήστε/μετρήστε την αλλαγή χρώματος ή τον φθορισμό και ποσοτικοποιήστε τη συγκέντρωση αντιγόνου (για παράδειγμα, χρησιμοποιώντας έναν αναγνώστη πλακών μικροτιτλοδότησης).

Μια μέθοδος ELISA αποτελεσματική για την ανίχνευση αντιγόνων SARS-CoV κυτταρικής επιφάνειας είναι η άμεση κυτταρική ELISA. Εν συντομία, τα κύτταρα που υποπτεύονται ότι εμφανίζουν αντιγόνο SARS-CoV στην κυτταρική επιφάνεια σταθεροποιούνται (για παράδειγμα, χρησιμοποιώντας γλουταραλδεyδη) και επωάζονται με ένα αντίσωμα ειδικό για τον SARS-CoV που συνδέεται με ένα ανιχνεύσιμο τμήμα (για παράδειγμα, ένζυμο υπεροξειδάσης χρένου ή ένζυμο αλκαλικής φωσφατάσης) Το Μετά από πλύση για την απομάκρυνση του μη δεσμευμένου αντισώματος, προστίθεται υπόστρωμα για το ένζυμο και παρατηρείται/μετριέται αλλαγή χρώματος ή φθορισμός.

Η παρούσα αποκάλυψη παρέχει περαιτέρω μεθόδους ανίχνευσης αντισώματος αντιδραστικού SARS-CoV σε δείγμα και/ή διάγνωσης λοίμωξης SARS-CoV σε άτομο με ανίχνευση αντισώματος αντιδραστικού SARS-CoV. Παραδείγματα τέτοιων μεθόδων περιλαμβάνουν την επαφή του δείγματος με ένα πολυπεπτίδιο SARS-CoV αυτής της αποκάλυψης υπό συνθήκες όπου μπορεί να σχηματιστεί ένα σύμπλεγμα πολυπεπτιδίου/αντισώματος. και ανίχνευση σχηματισμού του συμπλόκου, ανιχνεύοντας έτσι αντίσωμα SARS-CoV σε ένα δείγμα και/ή διάγνωση λοίμωξης SARS-CoV σε ένα άτομο. Τα σκεπτόμενα δείγματα που υπόκεινται σε ανάλυση με αυτές τις μεθόδους μπορούν να περιλαμβάνουν οποιοδήποτε δείγμα, όπως ένα κλινικό δείγμα, όπως περιγράφεται εδώ ως χρήσιμο για την ανίχνευση ιογενούς λοίμωξης σε ένα άτομο.

Οι μέθοδοι για την ανίχνευση αντισωμάτων σε ένα δείγμα συζητούνται, για παράδειγμα, στους Ausubel et al. Σύντομα Πρωτόκολλα στη Μοριακή Βιολογία, 4 ουεκδ., John Wiley & Sons, Inc., 1999. Οι ανοσοπροσδιορισμοί ενζύμων όπως IFA, ELISA και ανοσοκηλίδωση μπορούν εύκολα να προσαρμοστούν για να επιτευχθεί η ανίχνευση αντισωμάτων SARS-CoV σύμφωνα με τις μεθόδους αυτής της αποκάλυψης. Μια μέθοδος ELISA αποτελεσματική για την ανίχνευση συγκεκριμένων αντισωμάτων SARS-CoV είναι η έμμεση μέθοδος ELISA. Εν συντομία: 1) συνδέστε ένα πολυπεπτίδιο SARS-CoV σε ένα υπόστρωμα (για παράδειγμα, μια πλάκα μικροτιτλοδότησης). 2) επικοινωνήστε με το δεσμευμένο πολυπεπτίδιο με ένα δείγμα που είναι ύποπτο ότι περιέχει αντίσωμα SARS-CoV. 3) επικοινωνήστε με τα παραπάνω με ένα δευτερεύον αντίσωμα συνδεδεμένο σε ανιχνεύσιμο τμήμα το οποίο είναι αντιδραστικό με το δεσμευμένο αντίσωμα (για παράδειγμα, ένζυμο υπεροξειδάση χρένου ή ένζυμο αλκαλικής φωσφατάσης). 4) επαφή των παραπάνω με το υπόστρωμα για το ένζυμο. και 5) παρατηρήστε/μετρήστε την αλλαγή χρώματος ή τον φθορισμό.

Μια άλλη ανοσολογική τεχνική που μπορεί να είναι χρήσιμη στην ανίχνευση αντισωμάτων SARS-CoV χρησιμοποιεί μονοκλωνικά αντισώματα για ανίχνευση αντισωμάτων ειδικά αντιδραστικά με πολυπεπτίδια SARS-CoV σε ανταγωνιστική δοκιμασία αναστολής. Εν συντομία, ένα δείγμα που υποπτεύεται ότι περιέχει αντισώματα SARS-CoV έρχεται σε επαφή με ένα πολυπεπτίδιο SARS-CoV αυτής της αποκάλυψης το οποίο συνδέεται με ένα υπόστρωμα (για παράδειγμα, μια πλάκα μικροτιτλοδότησης). Το περίσσευμα του δείγματος ξεπλένεται καλά. Ένα επισημασμένο (για παράδειγμα, συνδεδεμένο με ένζυμα, φθορίζον, ραδιενεργό και παρόμοια) μονοκλωνικό αντίσωμα ειδικό για το πολυπεπτίδιο SARS-CoV έρχεται στη συνέχεια σε επαφή με τυχόν προηγουμένως σχηματισμένα σύμπλοκα πολυπεπτιδίου-αντισώματος και μετράται η ποσότητα σύνδεσης μονοκλωνικού αντισώματος. Η ποσότητα της αναστολής της σύνδεσης των μονοκλωνικών αντισωμάτων μετριέται σε σχέση με τον έλεγχο (χωρίς μονοκλωνικό αντίσωμα), επιτρέποντας την ανίχνευση και τη μέτρηση του αντισώματος στο δείγμα. Ο βαθμός αναστολής μονοκλωνικών αντισωμάτων μπορεί να είναι ένας πολύ ειδικός προσδιορισμός για την ανίχνευση του SARS-CoV. Τα μονοκλωνικά αντισώματα μπορούν επίσης να χρησιμοποιηθούν για άμεση ανίχνευση του SARS-CoV σε κύτταρα ή δείγματα ιστών, για παράδειγμα, με ανάλυση IFA σύμφωνα με τυπικές μεθόδους.

Ως ένα περαιτέρω παράδειγμα, μπορεί να χρησιμοποιηθεί μια δοκιμή μικροσυγκολλήσεως για τον εντοπισμό της παρουσίας αντισωμάτων SARS-CoV σε ένα δείγμα. Εν συντομία, τα σφαιρίδια λατέξ, τα ερυθρά αιμοσφαίρια ή άλλα σωματίδια που μπορούν να συγκολληθούν επικαλύπτονται με ένα πολυπεπτίδιο SARS-CoV αυτής της αποκάλυψης και αναμειγνύονται με ένα δείγμα, έτσι ώστε αντισώματα στο δείγμα που είναι ειδικά αντιδραστικά με το αντιγόνο σταυρωτά με το αντιγόνο, προκαλώντας συγκόλληση. Τα συγκολλημένα συμπλέγματα πολυπεπτιδίου-αντισώματος σχηματίζουν ένα ίζημα, ορατό με γυμνό μάτι ή μετρήσιμο με φασματοφωτόμετρο. Σε μια τροποποίηση της παραπάνω δοκιμής, τα ειδικά αντισώματα SARS-CoV αυτής της αποκάλυψης μπορούν να συνδεθούν με τα συγκολλήσιμα σωματίδια και το αντιγόνο SARS-CoV στο δείγμα που ανιχνεύονται.

VII. Φαρμακευτικές και ανοσοδιεγερτικές συνθέσεις και χρήσεις αυτών

Φαρμακευτικές συνθέσεις που περιλαμβάνουν αλληλουχίες νουκλεϊκών οξέων SARS-CoV, πολυπεπτίδια SARS-CoV ή αντισώματα που δεσμεύουν αυτά τα πολυπεπτίδια, περιλαμβάνονται επίσης στην παρούσα αποκάλυψη. Αυτές οι φαρμακευτικές συνθέσεις περιλαμβάνουν μια θεραπευτικά αποτελεσματική ποσότητα ενός ή περισσοτέρων πολυπεπτιδίων SARS-CoV, ενός ή περισσοτέρων μορίων νουκλεϊκού οξέος που κωδικοποιούν ένα πολυπεπτίδιο SARS-CoV ή ένα αντίσωμα που δεσμεύει ένα πολυπεπτίδιο SARS-CoV, σε συνδυασμό με έναν φαρμακευτικά αποδεκτό φορέα.

Αποκαλύπτονται εδώ ουσίες κατάλληλες για χρήση ως ανοσοδιεγερτικές συνθέσεις για την αναστολή ή θεραπεία του SARS. Ιδιαίτερες ανοσοδιεγερτικές συνθέσεις στρέφονται κατά του SARS-CoV και περιλαμβάνουν αντιγόνα που λαμβάνονται από τον SARS-CoV. Σε μία εφαρμογή, μια ανοσοδιεγερτική σύνθεση περιέχει εξασθενημένο SARS-CoV. Οι μέθοδοι εξασθένησης του ιού είναι πολύ γνωστές στην τεχνική και περιλαμβάνουν, αλλά δεν περιορίζονται σε αυτές, υψηλή σειριακή διέλευση (για παράδειγμα, σε ευαίσθητα κύτταρα ξενιστές υπό συγκεκριμένες περιβαλλοντικές συνθήκες για επιλογή για εξασθενημένα ιοσωματίδια), έκθεση σε μεταλλαξιογόνο παράγοντα (για παράδειγμα , χημικό μεταλλαξιογόνο ή ακτινοβολία), γενετική μηχανική χρησιμοποιώντας τεχνολογία ανασυνδυασμένου DNA (για παράδειγμα, χρήση γονιδιακής αντικατάστασης ή γονιδιακού νοκ -άουτ για την απενεργοποίηση ενός ή περισσότερων γονιδίων του ιού), ή κάποιου συνδυασμού αυτών.

Σε μια άλλη εφαρμογή, η ανοσοδιεγερτική σύνθεση περιέχει απενεργοποιημένο SARS-CoV. Οι μέθοδοι απενεργοποίησης του ιού είναι πολύ γνωστές στην τεχνική και περιλαμβάνουν, αλλά δεν περιορίζονται σε αυτές, τη θερμότητα και τις χημικές ουσίες (για παράδειγμα, φορμαλίνη, β-προπιολακτόνη και αιθυλενιμίνες).

Σε άλλη ακόμη υλοποίηση, η ανοσοδιεγερτική σύνθεση περιέχει φορέα νουκλεϊκού οξέος που περιλαμβάνει μόρια νουκλεϊκού οξέος SARS-CoV που περιγράφονται εδώ, ή που περιλαμβάνει αλληλουχία νουκλεϊκού οξέος που κωδικοποιεί ανοσογονικό πολυπεπτίδιο ή θραύσμα πολυπεπτιδίου του SARS-CoV ή προέρχεται από SARS-CoV, όπως ένα πολυπεπτίδιο που κωδικοποιεί μια επιφανειακή πρωτεΐνη του SARS-CoV.

Σε μια περαιτέρω ενσωμάτωση, η ανοσοδιεγερτική σύνθεση περιέχει μια υπομονάδα SARS-CoV, όπως γλυκοπρωτεΐνη, κύρια πρωτεΐνη καψιδίου ή άλλα γονιδιακά προϊόντα που βρέθηκαν να προκαλούν χυμικές και/ή κυτταρικές ανοσολογικές αποκρίσεις.

Τα παρεχόμενα ανοσοδιεγερτικά πολυπεπτίδια SARS-CoV, κατασκευές ή φορείς που κωδικοποιούν τέτοια πολυπεπτίδια, συνδυάζονται με φαρμακευτικά αποδεκτό φορέα ή φορέα για χορήγηση ως ανοσοδιεγερτική σύνθεση σε άτομα ή ζώα. Σε ορισμένες εφαρμογές, περισσότερα από ένα πολυπεπτίδια SARS-CoV που διεγείρουν το ανοσοποιητικό μπορούν να συνδυαστούν για να σχηματίσουν ένα μόνο παρασκεύασμα.

Τα ανοσογόνα σκευάσματα μπορούν εύκολα να παρουσιαστούν σε μορφή μοναδιαίας δοσολογίας και να παρασκευαστούν χρησιμοποιώντας συμβατικές φαρμακευτικές τεχνικές. Τέτοιες τεχνικές περιλαμβάνουν το βήμα της σύνδεσης του δραστικού συστατικού και του φαρμακευτικού φορέα ή των εκδόχων. Γενικά, τα σκευάσματα παρασκευάζονται με ομοιόμορφη και στενή σύνδεση του ενεργού συστατικού με υγρούς φορείς. Τα σκευάσματα που είναι κατάλληλα για παρεντερική χορήγηση περιλαμβάνουν υδατικά και μη υδατικά αποστειρωμένα διαλύματα ένεσης που μπορεί να περιέχουν αντιοξειδωτικά, ρυθμιστικά, βακτηριοστατικά και διαλυμένες ουσίες που καθιστούν το σκεύασμα ισοτονικό με το αίμα του προοριζόμενου δέκτη. και υδατικά και μη υδατικά στείρα εναιωρήματα που μπορεί να περιλαμβάνουν παράγοντες εναιώρησης και πυκνωτικούς παράγοντες. Τα σκευάσματα μπορεί να παρουσιάζονται σε δοχεία μονάδας δόσης ή πολλαπλών δόσεων, για παράδειγμα, σφραγισμένες αμπούλες και φιαλίδια, και μπορούν να αποθηκευτούν σε λυοφιλιωμένη (λυοφιλοποιημένη) κατάσταση που απαιτεί μόνο την προσθήκη ενός στείρου υγρού φορέα, για παράδειγμα, ενέσιμο νερό, αμέσως πριν από τη χρήση. Εξωτερικά διαλύματα ένεσης και εναιωρήματα μπορούν να παρασκευαστούν από αποστειρωμένες σκόνες, κόκκους και δισκία που χρησιμοποιούνται συνήθως από έναν έμπειρο στην τέχνη.

Σε ορισμένες υλοποιήσεις, τα σκευάσματα μοναδιαίας δοσολογίας είναι εκείνα που περιέχουν μια δόση ή μονάδα, ή ένα κατάλληλο κλάσμα αυτών, του χορηγούμενου συστατικού. Θα πρέπει να γίνει κατανοητό ότι εκτός από τα συστατικά που προαναφέρθηκαν ιδιαίτερα, τα σκευάσματα που περιλαμβάνονται στο παρόν μπορεί να περιλαμβάνουν και άλλους παράγοντες που χρησιμοποιούνται συνήθως από έναν έμπειρο στην τέχνη.

Οι συνθέσεις που παρέχονται εδώ, συμπεριλαμβανομένων εκείνων για χρήση ως ανοσοδιεγερτικές συνθέσεις, μπορούν να χορηγηθούν μέσω διαφορετικών οδών, όπως από του στόματος, συμπεριλαμβανομένων στοματικής και υπογλώσσιας, ορθικής, παρεντερικής, αεροζόλ, ρινικής, ενδομυϊκής, υποδόριας, ενδοδερμικής και τοπικής. Μπορούν να χορηγηθούν σε διαφορετικές μορφές, συμπεριλαμβανομένων αλλά χωρίς περιορισμό σε διαλύματα, γαλακτώματα και εναιωρήματα, μικροσφαίρες, σωματίδια, μικροσωματίδια, νανοσωματίδια και λιποσώματα.

Ο όγκος της χορήγησης θα ποικίλει ανάλογα με τον τρόπο χορήγησης. Για παράδειγμα, οι ενδομυϊκές ενέσεις μπορεί να κυμαίνονται από περίπου 0,1 ml έως περίπου 1,0 ml. Οι συνήθεις ειδικοί στην τέχνη θα γνωρίζουν κατάλληλους τόμους για διαφορετικούς τρόπους χορήγησης.

Μια σχετικά πρόσφατη εξέλιξη στον τομέα των ανοσοδιεγερτικών ενώσεων (για παράδειγμα, εμβόλια) είναι η άμεση έγχυση μορίων νουκλεϊκού οξέος που κωδικοποιούν πεπτιδικά αντιγόνα (περιγράφεται ευρέως στο Janeway & Travers, Immunobiology: The Immune System In Health and Disease , σελίδα 13.25, Garland Publishing, Inc., New York, 1997 · και McDonnell & Askari, N. Engl. J. Med. 334: 42-45, 1996). Φορείς που περιλαμβάνουν μόρια νουκλεϊκού οξέος που περιγράφονται εδώ ή που περιλαμβάνουν αλληλουχία νουκλεϊκού οξέος που κωδικοποιεί ανοσογόνο πολυπεπτίδιο SARS-CoV μπορεί να χρησιμοποιηθούν σε τέτοιες μεθόδους εμβολιασμού DNA.

Έτσι, ο όρος «ανοσοδιεγερτική σύνθεση» όπως χρησιμοποιείται εδώ περιλαμβάνει επίσης εμβόλια νουκλεϊκού οξέος στα οποία ένα μόριο νουκλεϊκού οξέος που κωδικοποιεί ένα πολυπεπτίδιο SARS-CoV χορηγείται σε ένα άτομο σε φαρμακευτική σύνθεση. Για τη γενετική ανοσοποίηση, οι κατάλληλες μέθοδοι χορήγησης που είναι γνωστές στους ειδικούς περιλαμβάνουν την άμεση έγχυση πλασμιδικού DNA στους μυς (Wolff et al., Hum. Mol. Genet. 1: 363, 1992), χορήγηση DNA συμπλεγμένου με ειδικούς φορείς πρωτεΐνης ( Wu et al., J. Biol. Chem. 264: 16985, 1989), συν-καταβύθιση του DNA με φωσφορικό ασβέστιο (Benvenisty and Reshef, Proc. Natl. Acad. Sci. 83: 9551, 1986), ενθυλάκωση του DNA σε λιποσώματα (Kaneda et al., Science 243: 375, 1989), βομβαρδισμός σωματιδίων (Tang et al.,Nature 356: 152, 1992; Eisenbraun et al., DNA Cell Biol. 12: 791, 1993), και ίη νίνο μόλυνση χρησιμοποιώντας κλωνοποιημένους ρετροϊικούς φορείς (Seeger et al., Proc. Natl. Acad. Sci. 81: 5849, 1984). Ομοίως, τα παρασκευάσματα εμβολίου νουκλεϊκού οξέος μπορούν να χορηγηθούν μέσω ιικού φορέα.

Η ποσότητα της ανοσοδιεγερτικής ένωσης σε κάθε δόση μιας ανοσοδιεγερτικής σύνθεσης επιλέγεται ως μια ποσότητα που προκαλεί μια ανοσοδιεγερτική ή ανοσοπροστατευτική απόκριση χωρίς σημαντικές, αρνητικές παρενέργειες. Μια τέτοια ποσότητα θα ποικίλει ανάλογα με το ποιο συγκεκριμένο ανοσογόνο χρησιμοποιείται και πώς παρουσιάζεται. Οι αρχικές ενέσεις μπορεί να κυμαίνονται από περίπου 1 μg έως περίπου 1 mg, με ορισμένες εφαρμογές να έχουν εύρος από περίπου 10 μg έως περίπου 800 μg και άλλες υλοποιήσεις κυμαίνονται από περίπου 25 μg έως περίπου 500 μg. Μετά από μια αρχική χορήγηση της ανοσοδιεγερτικής σύνθεσης, τα άτομα μπορούν να λάβουν μία ή περισσότερες αναμνηστικές χορηγήσεις, σε επαρκή απόσταση. Οι αναμνηστικές χορηγήσεις μπορεί να κυμαίνονται από περίπου 1 μg έως περίπου 1 mg, με άλλες εφαρμογές να έχουν εύρος περίπου 10 μg έως περίπου 750 μg, και άλλοι κυμαίνονται από περίπου 50 μg έως περίπου 500 μg. Περιοδικοί ενισχυτές σε διαστήματα 1-5 ετών, για παράδειγμα τρία έτη, μπορεί να είναι επιθυμητοί για τη διατήρηση των επιθυμητών επιπέδων προστατευτικής ανοσίας.

Θεωρείται επίσης ότι τα παρεχόμενα ανοσοδιεγερτικά μόρια και συνθέσεις μπορούν να χορηγηθούν σε ένα άτομο έμμεσα, διεγείροντας πρώτα ένα κύτταρο in vitro, το οποίο διεγερμένο κύτταρο χορηγείται στη συνέχεια στο άτομο για να προκαλέσει μια ανοσοαπόκριση. Επιπλέον, οι φαρμακευτικές ή ανοσοδιεγερτικές συνθέσεις ή μέθοδοι θεραπείας μπορούν να χορηγηθούν σε συνδυασμό με άλλες θεραπευτικές αγωγές.

VIII. Κιτ

Επίσης παρέχονται εδώ κιτ χρήσιμα στην ανίχνευση και/ή τη διάγνωση του SARS-CoV. Αυτό περιλαμβάνει κιτ για χρήση με μεθόδους ανίχνευσης νουκλεϊκού οξέος και πρωτεΐνης, όπως αυτές που αποκαλύπτονται εδώ.

Οι ειδικοί SARS-CoV ολιγονουκλεοτιδικοί εκκινητές και ανιχνευτές που περιγράφονται εδώ μπορούν να διατεθούν με τη μορφή ενός κιτ για χρήση στην ανίχνευση του SARS-CoV. Σε ένα τέτοιο κιτ, μια κατάλληλη ποσότητα ενός ή περισσοτέρων ολιγονουκλεοτιδίων παρέχεται σε ένα ή περισσότερα δοχεία ή διατηρείται σε ένα υπόστρωμα. Ένας ολιγονουκλεοτιδικός εκκινητής ή ανιχνευτής μπορεί να παρέχεται σε υδατικό διάλυμα ή ως λυοφιλιωμένη ή λυοφιλοποιημένη σκόνη, για παράδειγμα. Ο (οι) περιέκτης (-οι) στον οποίο παρέχονται τα ολιγονουκλεοτίδια (-α) μπορεί να είναι οποιοσδήποτε συμβατικός περιέκτης που μπορεί να συγκρατήσει την παρεχόμενη μορφή, για παράδειγμα, σωλήνες μικροφυγοκέντρησης, αμπούλες ή φιάλες. Σε ορισμένες εφαρμογές, ζεύγη εκκινητών παρέχονται σε προκαθορισμένες ποσότητες μίας χρήσης σε μεμονωμένους (τυπικά μιας χρήσης) σωλήνες ή ισοδύναμα δοχεία. Με μια τέτοια διάταξη,

Η ποσότητα κάθε ολιγονουκλεοτιδίου που παρέχεται στο κιτ μπορεί να είναι οποιαδήποτε κατάλληλη ποσότητα και μπορεί να εξαρτάται από την αγορά στην οποία κατευθύνεται το προϊόν. Για παράδειγμα, εάν το κιτ είναι προσαρμοσμένο για έρευνα ή κλινική χρήση, η ποσότητα κάθε παρεχόμενου ολιγονουκλεοτιδικού εκκινητή θα ήταν πιθανώς μια ποσότητα επαρκής για την εκκίνηση πολλών αντιδράσεων ενίσχυσης PCR. Γενικές κατευθυντήριες γραμμές για τον καθορισμό των κατάλληλων ποσοτήτων μπορούν να βρεθούν, για παράδειγμα, στο Sambrook et al., Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001; Ausubel et αϊ. (επιμ.), Short Protocols in Molecular Biology , John Wiley and Sons, New York, NY, 1999; and Innis et al., PCR Applications, Protocols for Functional Genomics, Academic Press, Inc., San Diego, Calif., 1999. Ένα κιτ μπορεί να περιλαμβάνει περισσότερους από δύο εκκινητές, προκειμένου να διευκολυνθεί η ενίσχυση ενός μεγαλύτερου αριθμού αλληλουχιών νουκλεοτιδίων SARS-CoV.

Σε ορισμένες εφαρμογές, τα κιτ περιλαμβάνουν επίσης ένα ή περισσότερα αντιδραστήρια απαραίτητα για τη διεξαγωγή αντιδράσεων ενίσχυσης in vitro, συμπεριλαμβανομένων αντιδραστηρίων παρασκευής δείγματος DNA, κατάλληλων ρυθμιστικών διαλυμάτων (για παράδειγμα, ρυθμιστικού πολυμεράσης), αλάτων (για παράδειγμα, χλωριούχου μαγνησίου) και δεοξυριβονουκλεοτιδίων (dNTP5) Το

Τα κιτ μπορούν να περιλαμβάνουν είτε επισημασμένους είτε μη επισημασμένους ολιγονουκλεοτιδικούς εκκινητές και/ή ανιχνευτές για χρήση στην ανίχνευση αλληλουχιών νουκλεοτιδίων SARS-CoV. Οι κατάλληλες αλληλουχίες για έναν τέτοιο ανιχνευτή θα είναι οποιαδήποτε αλληλουχία που εμπίπτει μεταξύ των θέσεων ανόπτησης των δύο παρεχόμενων ολιγονουκλεοτιδικών εκκινητών, έτσι ώστε η αλληλουχία στην οποία ο ανιχνευτής είναι συμπληρωματικός να ενισχύεται κατά την αντίδραση ενίσχυσης.

Μία ή περισσότερες αλληλουχίες ελέγχου για χρήση στις αντιδράσεις ενίσχυσης μπορούν επίσης να παρέχονται στο κιτ. Σε άλλες συγκεκριμένες εφαρμογές, το κιτ περιλαμβάνει εξοπλισμό, αντιδραστήρια και οδηγίες για την εξαγωγή και/ή τον καθαρισμό νουκλεοτιδίων από ένα δείγμα.

Τα κιτ για την ανίχνευση αντιγόνου SARS-CoV περιλαμβάνουν για παράδειγμα τουλάχιστον έναν παράγοντα δέσμευσης ειδικού για το αντιγόνο SARS-CoV (για παράδειγμα, ένα πολυκλωνικό ή μονοκλωνικό αντίσωμα ή θραύσμα αντισώματος). Τα κιτ μπορούν επίσης να περιλαμβάνουν μέσα για την ανίχνευση αντιγόνου: σύμπλοκα ειδικών δεσμευτικών παραγόντων, για παράδειγμα ο ειδικός συνδετικός παράγοντας μπορεί να επισημανθεί με ανίχνευση. Εάν ο ειδικός συνδετικός παράγοντας δεν είναι επισημασμένος, μπορεί να ανιχνευθεί με δεύτερα αντισώματα ή πρωτεΐνη Α, για παράδειγμα, που μπορεί επίσης να παρέχεται σε ορισμένα κιτ σε ένα ή περισσότερα ξεχωριστά δοχεία. Τέτοιες τεχνικές είναι πολύ γνωστές.

Ένα άλλο παράδειγμα ενός κιτ δοκιμασίας που παρέχεται εδώ είναι ένα ανασυνδυασμένο ειδικό για το SARS-CoV πολυπεπτίδιο (ή θραύσμα αυτού) ως αντιγόνο και ένα συζευγμένο με ένζυμο αντι-ανθρώπινο αντίσωμα ως δεύτερο αντίσωμα. Παραδείγματα τέτοιων κιτ μπορούν επίσης να περιλαμβάνουν ένα ή περισσότερα ενζυματικά υποστρώματα. Τέτοια κιτ μπορούν να χρησιμοποιηθούν για έλεγχο εάν ένα δείγμα από ένα άτομο περιέχει αντισώματα έναντι ειδικής πρωτεΐνης SARS-CoV.

Το αντικείμενο της παρούσας αποκάλυψης επεξηγείται περαιτέρω με τα ακόλουθα μη περιοριστικά Παραδείγματα.

ΠΑΡΑΔΕΙΓΜΑΤΑΠαράδειγμα 1Απομόνωση και Χαρακτηρισμός του SARS-CoV

Απομόνωση ιών και υπερδομικός χαρακτηρισμός

Αυτό το παράδειγμα περιγράφει την αρχική απομόνωση και χαρακτηρισμό ενός νέου ανθρώπινου κορονοϊού από ασθενείς με SARS.

Μια ποικιλία κλινικών δειγμάτων (αίμα, ορός, υλικό από στοματοφαρυγγικά επιχρίσματα ή πλύσεις, υλικό από ρινοφαρυγγικά επιχρίσματα και ιστούς μεγάλων οργάνων που συλλέχθηκαν κατά την αυτοψία) από ασθενείς που πληρούσαν τον ορισμό περίπτωσης του SARS εστάλησαν στα Κέντρα Ελέγχου και Πρόληψης Νοσημάτων ( CDC) ως μέρος της αιτιολογικής έρευνας του SARS. Αυτά τα δείγματα εμβολιάστηκαν σε έναν αριθμό συνεχών κυτταρικών σειρών, συμπεριλαμβανομένων των κυττάρων Vero E6, NCI-H292, MDCK, LLC-MK2 και B95-8 και σε θηλάζοντες ποντικούς ICR με ενδοκρανιακή και ενδοπεριτοναϊκή οδό. Όλες οι καλλιέργειες παρατηρήθηκαν καθημερινά για CPE. Το μέσο συντήρησης αναπληρώθηκε την έβδομη ημέρα και οι καλλιέργειες τερματίστηκαν δεκατέσσερις ημέρες μετά τον εμβολιασμό. Οποιεσδήποτε καλλιέργειες εμφανίζουν αναγνωρίσιμη CPE υποβλήθηκαν σε διάφορες διαδικασίες για τον προσδιορισμό της αιτίας του αποτελέσματος. Ποντίκια που θηλάζουν παρατηρήθηκαν καθημερινά για δεκατέσσερις ημέρες και τυχόν άρρωστα ή νεκρά ποντίκια δοκιμάστηκαν περαιτέρω με την παρασκευή ενός εναιωρήματος εγκεφάλου που φιλτραρίστηκε και υποκαλλιεργήθηκε. Τα ποντίκια που παρέμειναν καλά μετά από δεκατέσσερις ημέρες σκοτώθηκαν και τα αποτελέσματα των δοκιμών τους καταγράφηκαν ως αρνητικά.

Δύο κυτταρικές σειρές, κύτταρα Vero E6 και κύτταρα NCI-H292, εμβολιασμένα με στοματοφαρυγγικά δείγματα από τον Ασθενή 16 (ένας άνδρας 46 ετών με επιδημιολογική σύνδεση με νοσοκομείο με πολλαπλούς ασθενείς με SARS) έδειξαν αρχικά CPE (Πίνακας 1)

ΤΡΑΠΕΖΙ 1

Δείγματα ασθενών με SARS που ήταν θετικά για SARS-CoV με μία ή περισσότερες μεθόδους*.

Εκθεση

Ευρήματα

Υπομονετικος

και

στο στήθος

Νοσοκομείο-

Ορολογικά

Οχι

Σύνθεση

Ηλικία/Φύλο

Ακτινογραφία

απομόνωση

Αποτελέσματα

Δείγμα

Απομόνωση

RT-PCR

1

Σιγκαπούρη,

53 ετών/F

Πνευμονία

Ναί

+

Ρινική, στοματοφαρυγγική

Δεν

νοσοκομείο

μπατονέτες

Έγινε

2†

Χονγκ Κονγκ,

36 ετών/F

Πνευμονία

Ναί

+

Ρινική, μπατονέτα

Δεν

ξενοδοχειο

Έγινε

3

Χονγκ Κονγκ,

22 ετών/Μ

Πνευμονία

Ναί

+

Μάκτρο

ξενοδοχειο

4†

Χονγκ Κονγκ,

39 ετών/Μ

Πνευμονία

Ναί

+

Ρινική, φαρυγγική μπατονέτα

ξενοδοχειο

5

Χονγκ Κονγκ,

49 ετών/Μ

Πνευμονία

Ναί

Δεν

Πτύελο

+

+

ξενοδοχειο

Έγινε

6‡

Χονγκ Κονγκ,

46 ετών/Μ

Πνευμονία

Ναί

+

Νεφρός, πνεύμονας, βρογχο-

+

ξενοδοχειο

κυψελιδική πλύση

7

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

+

νοσοκομείο

άγνωστος

8

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

9

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

10

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

11

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

12

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

13

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

+

νοσοκομείο

άγνωστος

14

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

15

Βιετνάμ,

Ενήλικας/

Πνευμονία

Ναί

Στοματικό πλύσιμο

+

νοσοκομείο

άγνωστος

16

Βιετνάμ,

46 ετών/Μ

Πνευμονία

Ναί

+

Ρινική, στοματοφαρυγγική

+

νοσοκομείο

μπατονέτες

17

Καναδάς,

43 ετών/Μ

Πνευμονία

Ναί

Δεν

Πνεύμονας, μυελός των οστών

οικογένεια

Έγινε

18

Ταϊβάν,

51 ετών/F

Πνευμονία

Ναί

Πτύελο

+

οικογένεια

19

Χονγκ Κονγκ,

Ενήλικας/ΣΤ

Πνευμονία

Ναί

+

Στοματικό πλύσιμο

+

ξενοδοχειο

*Τα σύμβολα συν υποδηλώνουν θετικά αποτελέσματα και μείον τα αρνητικά. Οι ορολογικές και RT-PCR δοκιμασίες δεν πραγματοποιήθηκαν απαραίτητα σε δείγματα που ελήφθησαν ταυτόχρονα.

† Αυτό ήταν ένα δείγμα που είχε καθυστερήσει, θετικό αντίσωμα στο πρώτο δείγμα.

‡ Τα ταξίδια περιελάμβαναν την Κίνα, το Χονγκ Κονγκ (ξενοδοχείο) και το Ανόι (ο ασθενής ήταν ο ασθενής δείκτης στο Γαλλικό Νοσοκομείο).

Η απομόνωση έγινε μόνο από τα νεφρά.

Η απομόνωση έγινε μόνο από το στοματοφάρυγγα.

Το CPE στα κύτταρα Vero Ε6 σημειώθηκε για πρώτη φορά την πέμπτη ημέρα μετά τον εμβολιασμό. ήταν εστιακό, με κυτταρική στρογγυλοποίηση και διαθλαστική εμφάνιση στα προσβεβλημένα κύτταρα που σύντομα ακολούθησε κυτταρική αποκόλληση (ΣΥΚΟ. 1Α). Το CPE εξαπλώθηκε γρήγορα για να συμπεριλάβει ολόκληρη τη μονοστιβάδα κυττάρων εντός 24 έως 48 ωρών. Η υποκαλλιέργεια υλικού μετά την παρασκευή ενός βασικού αποθέματος σπόρων (που χρησιμοποιήθηκε για μετέπειτα παραγωγή αντιγόνου) είχε ως αποτέλεσμα την ταχεία εμφάνιση CPE, όπως σημειώθηκε παραπάνω, και πλήρη καταστροφή της μονοστιβάδας στις εμβολιασμένες φιάλες εντός 48 ωρών. Παρόμοιο CPE σημειώθηκε επίσης σε τέσσερις επιπλέον καλλιέργειες: τρεις καλλιέργειες αναπνευστικών δειγμάτων (δύο στοματοφαρυγγικές πλύσεις και ένα δείγμα πτυέλων) και μία καλλιέργεια εναιωρήματος νεφρικού ιστού που ελήφθη κατά την αυτοψία. Σε αυτά τα δείγματα, το αρχικό CPE παρατηρήθηκε μεταξύ της δεύτερης και της τέταρτης ημέρας και, όπως σημειώθηκε παραπάνω, το CPE προχώρησε γρήγορα για να συμπεριλάβει ολόκληρη την μονοστιβάδα κυττάρων.

Δείγματα καλλιέργειας ιστών που δείχνουν CPE παρασκευάστηκαν για μικροσκοπική ηλεκτρονική εξέταση. Μικροσκοπικά δείγματα αρνητικών λεκέδων παρασκευάστηκαν με ξήρανση υπερκειμένου καλλιέργειας, αναμειγνύονται 1: 1 με 2,5% παραφορμαλδεhyδη, σε πλέγματα επικαλυμμένα με ανθρακικό άνθρακα και χρωματίζονται με 2% βολφραμική μεθυλαμίνη. Λεπτά τμήματα ηλεκτρονικών μικροσκοπικών δειγμάτων παρασκευάστηκαν στερεώνοντας ένα πλέγμα κυττάρων που πλύθηκαν με 2,5% γλουταραλδεyδη και ενσωματώνοντας το σφαιρίδιο κυττάρου σε εποξειδική ρητίνη. Επιπλέον, παρασκευάστηκε ένα βασικό απόθεμα σπόρων από το υπόλοιπο υπερκείμενο καλλιέργειας και τα κύτταρα με κατάψυξη-απόψυξη της φιάλης καλλιέργειας, διαύγαση του αποψυγμένου περιεχομένου με φυγοκέντρηση στα 1000 × g και διανομή του υπερκειμένου σε κλάσματα που φυλάσσονται σε αέρια φάση πάνω από υγρό άζωτο. Το απόθεμα κύριου σπόρου υποκαλλιεργήθηκε σε 850 cm- 2κυλινδρικά μπουκάλια κυττάρων Vero E6 για την παρασκευή κυττάρων θετικού μάρτυρα σταθεροποιημένης με φορμαλίνη για ανοσοϊστοχημική ανάλυση, αναμεμειγμένα με κανονικά κύτταρα Vero E6 και ακτινοβολημένα με γ για την παρασκευή κηλίδων για δοκιμές IFA ή εκχυλισμένα με απορρυπαντικό και ακτινοβολημένα γ για χρήση ως αντιγόνο ELISA για δοκιμές αντισωμάτων.

Η εξέταση των CPE-θετικών κυττάρων Vero E6 με ηλεκτρονική μικροσκοπία λεπτής τομής αποκάλυψε χαρακτηριστικά σωματίδια κορονοϊού μέσα στις στέρνες του τραχύ ενδοπλασματικού δικτύου και σε κυστίδια (ΣΥΚΟ. 2Α) (Becker et al., J. Virol. 1: 1019-27, 1967, Oshiro et al. J. Gen. Virol. 12: 161-8, 1971). Βρέθηκαν εξωκυτταρικά σωματίδια σε μεγάλες συστάδες και προσκολλώνται στην επιφάνεια της μεμβράνης πλάσματος. Ηλεκτρονική μικροσκόπηση με αρνητικό λεκέ εντόπισε σωματίδια κορονοϊού, διαμέτρου 80 έως 140 nm, με περίπλοκες προεξοχές επιφάνειας 20 έως 40 nm που περιβάλλουν την περιφέρεια (ΣΥΚΟ. 2Β). Δεν παρατηρήθηκαν προβολές γλυκοπρωτεΐνης τύπου αιμαγλουτινίνης εστεράσης.

Η απομόνωση και η ανάπτυξη ενός ανθρώπινου κορωνοϊού στα κύτταρα Vero E6 ήταν απροσδόκητη. Οι παλαιότερα γνωστοί ανθρώπινοι κοροναϊοί είναι ιδιαίτερα επιθετικοί, προτιμούν επιλεγμένες κυτταρικές σειρές, καλλιέργεια οργάνων ή θηλάζουν ποντίκια για πολλαπλασιασμό. Ο μόνος κορωνοϊός ανθρώπου ή ζώου που έχει αποδειχθεί ότι αναπτύσσεται στα κύτταρα Vero E6 είναι το PEDV και απαιτεί την προσθήκη θρυψίνης στο μέσο καλλιέργειας για ανάπτυξη στα κύτταρα. Επιπλέον, το PEDV προσαρμοσμένο στην ανάπτυξη στα κύτταρα Vero E6 έχει ως αποτέλεσμα ένα εντυπωσιακά διαφορετικό CPE, με κυτταροπλασματικά κενοτόπια και σχηματισμό μεγάλων συγκυτίων. Συγκυτιακά κύτταρα παρατηρήθηκαν μόνο περιστασιακά σε μονοστιβάδες κυττάρων Vero Ε6 μολυσμένων με τον SARS-CoV. σαφώς δεν αντιπροσωπεύουν το κυρίαρχο CPE.

Αντίστροφη μεταγραφή-αλυσιδωτή αντίδραση πολυμεράσης και αλληλουχία

Για τους προσδιορισμούς RT-PCR, τα υπερκείμενα κυτταρικής καλλιέργειας τοποθετήθηκαν σε ρυθμιστικό λύσης. Τα εκχυλίσματα RNA παρασκευάστηκαν από 100 μl κάθε δείγματος (ή υπερκειμένου καλλιέργειας) με το αυτοματοποιημένο σύστημα εξαγωγής NucliSens (bioMérieux, Durham, NC). Αρχικά, εκφυλισμένοι, εκκινητές, που περιέχουν ινοσίνη, εκκινητές IN-2 (+) 5′GGGTTGGACACTA TCCTAAGTGTGA3 ′ (SEQ ID NO: 34) και IN-4 (-) 5′TAACACACAACICCATCA TCA3 ′ (SEQ ID NO: 35) σχεδιάστηκαν για ανόπτηση θέσεις που κωδικοποιούν συντηρημένα μοτίβα αμινοξέων που ταυτοποιήθηκαν με βάση τις ευθυγραμμίσεις των διαθέσιμων αλληλουχιών γονιδίου ORF1a, ORF1b, S, HE, M και Ν. Πρόσθετα, ειδικά για SARS, αστάρια Cor-p-F2 (+) 5′CTAACATGCTTAGGATAATGG3 ′ (SEQ ID NO: 13), Cor-p-F3 (+) 5′GCCTCTCTTGTTCTTGCTCGC3 ′ (SEQ ID NO: 14), και Cor- p-R1 (-) 5 ′ CAGGTAAGCGTAAAACTCATC3 ′ (SEQ ID NO: 15) σχεδιάστηκαν καθώς δημιουργήθηκαν αλληλουχίες από προϊόντα RT-PCR που ενισχύθηκαν με τους εκφυλισμένους εκκινητές. Αυτοί οι ειδικοί για SARS εκκινητές χρησιμοποιήθηκαν για τη δοκιμή δειγμάτων ασθενών για SARS (δείτε παρακάτω). Οι εκκινητές που χρησιμοποιούνται για ειδική ενίσχυση ανθρώπινου μεταπνευμοϊού έχουν περιγραφεί από τους Falsey et al. (J. Infect. Dis. 87: 785-90, 2003).

Για προϊόντα RT-PCR μικρότερης των 3 kb, το cDNA συντέθηκε σε μίγμα αντίδρασης 20 μl που περιέχει 500 ng RNA, 200 U αντίστροφης μεταγραφάσης Superscript ™ II (Invitrogen Life Technologies, Carlsbad, Calif.), 40 U RNasin ( Promega Corp., Madison, Wis.), 100 mM το καθένα dNTP (Roche Molecular Biochemicals, Indianapolis, Ind.), 4 μl ρυθμιστικού αντιδράσεων 5 ((Invitrogen Life Technologies, Carlsbad, Calif.), Και 200 ​​pmol του αντίστροφου αστάρι Το Το μίγμα της αντίδρασης, εκτός από την αντίστροφη μεταγραφάση, θερμάνθηκε στους 70 ° C για 2 λεπτά, ψύχθηκε στους 4 ° C για 5 λεπτά και στη συνέχεια θερμάνθηκε στους 42 ° C σε ένα θερμοκυκλοποιητή. Το μίγμα διατηρήθηκε στους 42 ° C για 4 λεπτά και στη συνέχεια προστέθηκε η αντίστροφη μεταγραφάση και οι αντιδράσεις επωάστηκαν στους 42 ° C για 45 λεπτά.2 , 200 mM το καθένα dNTP, και 2,5 U πολυμεράσης Taq DNA (Roche Molecular Biochemicals, Indianapolis, Ind.). Το πρόγραμμα θερμοκυκλώματος για την PCR συνίστατο σε 40 κύκλους μετουσίωσης στους 95 ° C για 30 δευτερόλεπτα, ανόπτηση στους 42 ° C για 30 δευτερόλεπτα και επέκταση στους 65 ° C για 30 δευτερόλεπτα. Για τα ειδικά αστάρια SARS-CoV, η θερμοκρασία ανόπτησης αυξήθηκε στους 55 ° C.

Για ενίσχυση θραυσμάτων μεγαλύτερης των 3 kb, οι περιοχές του γονιδιώματος μεταξύ τμημάτων γνωστής αλληλουχίας ενισχύθηκαν μέσω ενός μακρού πρωτοκόλλου RT-PCR και ειδικών εκκινητών SARS-CoV. Η σύνθεση πρώτου κλώνου cDNA πραγματοποιήθηκε στους 42 ° C ή 50 ° C. χρησιμοποιώντας αντίστροφη μεταγραφάση Superscript ™ II RNase H (Invitrogen Life Technologies, Carlsbad, Calif.) Σύμφωνα με τις οδηγίες του κατασκευαστή με μικρές τροποποιήσεις. Οι ειδικοί για τον κορονοϊό εκκινητές (500 ng) και το SARS-CoV RNA (350 ng) συνδυάστηκαν με το PCR Nucleotide Mix (Roche Molecular Biochemicals, Indianapolis, Ind.), Θερμάνθηκαν για 1 λεπτό στους 94 ° C και ψύχθηκαν στους 4 ° Γ. Σε θερμοκυκλοφορητή. Προστέθηκε το ρυθμιστικό διάλυμα 5 × πρώτου κλώνου, διθειοθρεϊτόλη (Invitrogen Life Technologies, Carlsbad, Calif.), Και Protector RNase Inhibitor (Roche Molecular Biochemicals, Indianapolis, Ind.), και τα δείγματα επωάστηκαν στους 42 ° C ή 50 ° C για 2 λεπτά. Αφού προστέθηκε αντίστροφη μεταγραφάση (200 U), τα δείγματα επωάστηκαν στους 42 ° C ή 50 ° C για 1,5 έως 2 ώρες. Τα δείγματα απενεργοποιήθηκαν στους 70 ° C για 15 λεπτά και στη συνέχεια κατεργάστηκαν με 2 U RNase H (Roche Molecular Biochemicals, Indianapolis, Ind.) Στους 37 ° C για 30 λεπτά. Μεγάλη ενίσχυση RT-PCR θραυσμάτων 5-8 kb πραγματοποιήθηκε χρησιμοποιώντας χάντρες Taq Plus Precision (Stratagene, La Jolla, Calif.) Και AmpliWax PCR Gem 100 (Applied Biosystems; Foster City, Calif.) Για PCR «hot start» με τις ακόλουθες παραμέτρους θερμοκυκλοφορίας: μετουσίωση στους 94 ° C για 1 λεπτό ακολουθούμενη από 35 κύκλους 94 ° C για 30 δευτερόλεπτα, 55 ° C για 30 δευτερόλεπτα, αύξηση 0,4 μοίρες ανά δευτερόλεπτο έως 72 ° C, και 72 ° C για 7 έως 10 λεπτά, με τελική επέκταση στους 72 ° C για 10 λεπτά.

Σε όλες τις περιπτώσεις, τα προϊόντα RT-PCR απομονώθηκαν σε γέλη και καθαρίστηκαν για προσδιορισμό αλληλουχίας μέσω ενός κιτ εκχύλισης QIAquick Gel (Qiagen, Inc., Santa Clarita, Καλιφόρνια). Αμφότερα τα σκέλη προσδιορίστηκαν με αυτοματοποιημένες μεθόδους, χρησιμοποιώντας τερματιστές φθορισμού διδεοξυ-αλυσίδας (Applied Biosystems, Foster City, Calif.).

Η αλληλουχία του οδηγού ελήφθη από το υπογονιδιακό mRNA που κωδικοποιεί το γονίδιο Ν και από το άκρο 5 “του γονιδιωματικού RNA. Η τεχνική ταχείας ενίσχυσης 5 “των άκρων cDNA (RACE) (Harcourt et al., Virology 271: 334-49, 2000) χρησιμοποιήθηκε με αντίστροφους εκκινητές ειδικούς για το γονίδιο Ν ή για την 5 ′ αμετάφραστη περιοχή. Τα προϊόντα RACE είτε αλληλουχήθηκαν απευθείας είτε κλωνοποιήθηκαν σε φορέα πλασμιδίου πριν από τον προσδιορισμό αλληλουχίας. Ένας εκκινητής που ήταν ειδικός για τον οδηγό του SARS-CoV χρησιμοποιήθηκε για την ενίσχυση της περιοχής μεταξύ του 5-άκρου του γονιδιώματος και των γνωστών αλληλουχιών στο γονίδιο rep. Το 3′-άκρο του γονιδιώματος ενισχύθηκε για προσδιορισμό αλληλουχίας με χρήση ολιγο- (dT) εκκινητή και εκκινητών ειδικών για το γονίδιο Ν.

Αφού προσδιορίστηκε η πλήρης γονιδιωματική αλληλουχία SARS-CoV, επιβεβαιώθηκε με προσδιορισμό αλληλουχίας μιας σειράς ανεξαρτήτως ενισχυμένων προϊόντων RT-PCR που εκτείνεται σε ολόκληρο το γονιδίωμα. Εναρκτήρια αλληλουχίας θετικής και αρνητικής αίσθησης, σε διαστήματα περίπου 300 nt, χρησιμοποιήθηκαν για να δημιουργήσουν μια επιβεβαιωτική αλληλουχία με μέσο πλεόνασμα 9,1. Η αλληλουχία επιβεβαίωσης ήταν πανομοιότυπη με την αρχική ακολουθία. Η γονιδιωματική αλληλουχία (SEQ ID ΝΟ: 1) δημοσιεύθηκε στη βάση δεδομένων ακολουθίας GenBank (Αριθμός Προσχώρησης AY278741) στις 21 Απριλίου 2003.

Ανάλυση ακολουθίας

Οι προβλεπόμενες αλληλουχίες αμινοξέων συγκρίθηκαν με αυτές από ιούς αναφοράς που αντιπροσωπεύουν κάθε είδος για τα οποία υπήρχαν πλήρεις πληροφορίες γονιδιωματικής αλληλουχίας: εκπρόσωποι της ομάδας 1 περιλάμβαναν τον ανθρώπινο κορονοϊό 229E (GenBank Accession No. AF304460), ιό διάρροιας χοίρων (GenBank Accession No. AF353511), και μεταδοτικός ιός γαστρεντερίτιδας (Αριθμός πρόσβασης GenBank αρ. AF271965). Οι εκπρόσωποι της ομάδας 2 περιλάμβαναν τον κορωνοϊό βοοειδών (GenBank Accession No. AF220295) και τον ιό της ηπατίτιδας του ποντικιού (GenBank Accession No. AF201929). Η ομάδα 3 εκπροσωπήθηκε από μολυσματικό ιό βρογχίτιδας (GenBank Accession No. M95169). Αλληλουχίες για αντιπροσωπευτικά στελέχη άλλων ειδών κορωνοϊού για τα οποία υπήρχαν πληροφορίες μερικής αλληλουχίας περιλήφθηκαν για μερικές από τις συγκρίσεις δομικών πρωτεϊνών: Τα αντιπροσωπευτικά στελέχη της ομάδας 1 περιελάμβαναν κορωνοϊό σκύλου (GenBank Accession No. D13096), κοροναϊός αιλουροειδών (GenBank Accession No. AY204704) και χοίρειος αναπνευστικός κοροναϊός (GenBank Accession No. Z24675). και οι εκπρόσωποι της ομάδας 2 περιελάμβαναν τρία στελέχη του ανθρώπινου κορωνοϊού OC43 (GenBank Accession Nos. M76373, L14643 και M93390), ιός εγκεφαλομυελίτιδας αιμοσυγκόλλησης χοίρου (GenBank Accession No. AY078417), και κορωνοϊό αρουραίου (GenBank Accession No. AF207551).

Μερικές νουκλεοτιδικές αλληλουχίες του γονιδίου πολυμεράσης ευθυγραμμίστηκαν με τις δημοσιευμένες αλληλουχίες κορωνοϊού, χρησιμοποιώντας CLUSTAL W για Unix (έκδοση 1.7, Thompson et al., Nucleic Acids Res. 22: 4673-80, 1994). Τα φυλογενετικά δέντρα υπολογίστηκαν με μέγιστη ανάλυση παρρησίας, απόστασης και μέγιστης πιθανότητας βάσει κριτηρίων με PAUP (έκδοση 4.0.d10; Swofford ed., Phylogenetic Analysis using Parsimony and other Methods), Sinauer Associates, Sunderland, Mass.). Σε σύγκριση με άλλους κορωνοϊούς ανθρώπων και ζώων, η αλληλουχία νουκλεοτιδίων και συμπερασμάτων αμινοξέων από αυτήν την περιοχή είχε βαθμούς ομοιότητας που κυμαίνονταν από 0,56 έως 0,63 και από 0,57 έως 0,74, αντίστοιχα. Η υψηλότερη ομοιότητα αλληλουχίας επιτεύχθηκε με τους κορονοϊούς της ομάδας ΙΙ. Το δέντρο μέγιστης παρρησίας που λαμβάνεται από την ευθυγράμμιση αλληλουχίας νουκλεοτιδίων φαίνεται στοΣΥΚΟ. 3Το Οι αναλύσεις του Bootstrap των εσωτερικών κόμβων στα εσωτερικά κλαδιά του δέντρου παρείχαν ισχυρές αποδείξεις ότι ο SARS-CoV είναι γενετικά διαφορετικός από άλλους γνωστούς κορωνοϊούς.

Οι αναλύσεις μικροσυστοιχιών (χρησιμοποιώντας μια μακρά μικροσυστοιχία ολιγονουκλεοτιδίου DNA με στοιχεία συστοιχίας που προέρχονται από εξαιρετικά διατηρημένες περιοχές εντός ιικών οικογενειών) δειγμάτων από μολυσμένες και μη μολυσμένες κυτταρικές καλλιέργειες έδωσαν ένα θετικό σήμα για μια ομάδα οκτώ ολιγονουκλεοτιδίων που προέρχονται από δύο οικογένειες ιών: Coronaviridae και Astroviridae (Wang et al., PNAS 99: 15687-92, 2002). Όλοι οι αστροϊοί και δύο από τα ολιγονουκλεοτίδια του κορωνοϊού μοιράζονται ένα μοτίβο αλληλουχίας συναίνεσης που αντιστοιχεί στο ακραίο 3ο άκρο των αστροϊών και δύο μέλη της οικογένειας του κοροναϊού: μολυσματική βρογχίτιδα των πτηνών και κοροναϊός γαλοπούλας (Jonassen et al., J. Gen. Virol. 79: 715-8, 1998). Τα αποτελέσματα ήταν σύμφωνα με την ταυτότητα του απομονωμένου ατόμου ως κορωνοϊού.

Πρόσθετες ευθυγραμμίσεις αλληλουχίας και δέντρα που συνδέονται με γείτονες δημιουργήθηκαν χρησιμοποιώντας ClustalX (Thompson et al., Nucleic Acids Res.25: 4876-82, 1997), έκδοση 1.83, με τη μήτρα σύγκρισης πρωτεϊνών Gonnet. Τα δέντρα που προέκυψαν προσαρμόστηκαν για την τελική απόδοση χρησιμοποιώντας treetool έκδοση 2.0.1. Οι μη διορθωμένες ζεύγη αποστάσεις υπολογίστηκαν από τις ευθυγραμμισμένες αλληλουχίες χρησιμοποιώντας το πρόγραμμα Distances από το πακέτο ανάλυσης ακολουθιών Wisconsin, έκδοση 10.2 (Accelrys, Burlington, Mass.). Οι αποστάσεις μετατράπηκαν σε εκατοστιαία ταυτότητα αφαιρώντας το 100. Οι αλληλουχίες αμινοξέων για τρεις καλά καθορισμένες ενζυματικές πρωτεΐνες που κωδικοποιούνται από το γονίδιο rep και οι τέσσερις κύριες δομικές πρωτεΐνες του SARS-CoV συγκρίθηκαν με αυτές των αντιπροσωπευτικών ιών για καθένα από τα είδη κορωνοϊός για τον οποίο υπήρχαν πλήρεις πληροφορίες γονιδιωματικής αλληλουχίας (ΣΥΚΟ. 4, Πίνακας 2). Οι τοπολογίες των φυλογραμιών που προκύπτουν είναι εξαιρετικά παρόμοιες (ΣΥΚΟ. 4). Για κάθε πρωτεΐνη που αναλύθηκε, τα είδη σχημάτισαν μονοφυλετικές συστάδες σύμφωνα με τις καθιερωμένες ταξινομικές ομάδες. Σε όλες τις περιπτώσεις, οι ακολουθίες SARS-CoV διαχωρίζονται σε έναν τέταρτο, καλά επιλυμένο κλάδο. Αυτές οι ομάδες υποστηρίχθηκαν με τιμές bootstrap άνω του 90% (1000 επαναλήψεις). Σύμφωνα με ζεύγη συγκρίσεις μεταξύ των προηγουμένως χαρακτηρισμένων ειδών κορωνοϊού (Πίνακας 2), υπήρξε μεγαλύτερη διατήρηση αλληλουχίας στις ενζυματικές πρωτεΐνες (3CL pro , πολυμεράση (POL) και ελικάση (HEL)) παρά στις δομικές πρωτεΐνες (S, E, M , και Ν). Αυτά τα αποτελέσματα υποδεικνύουν ότι ο SARS-CoV δεν σχετίζεται στενά με κανέναν από τους κορωνοϊούς που χαρακτηρίστηκαν προηγουμένως και σχηματίζει μια ξεχωριστή ομάδα στο γένος Coronavirus .

ΠΙΝΑΚΑΣ 2

Ταυτότητα ζεύγους αμινοξέων των πρωτεϊνών του κορωνοϊού.

Ομάδα

Ιός

3CLPRO

ΠΟΛ

ΟΛΟΚΛΗΡΟΣ

μικρό

ΚΑΙ

Μ

Ν

Ταυτότητα Pairwise Amino Acid (Ποσοστό)

G1

HCoV-229E

40.1

58.8

59.7

23.9

22.7

28.8

23.0

PEDV

44.4

59.5

61.7

21.7

17.6

31.8

22.6

TGEV

44.0

59.4

61.2

20.6

22.4

30.0

25.6

G2

BCoV

48.8

66.3

68.3

27.1

20.0

39.7

31.9

MHV

49.2

66.5

67.3

26.5

21.1

39.0

33.0

G3

IBV

41.3

62.5

58.6

21.8

18.4

27.2

24.0

Προβλεπόμενο μήκος πρωτεΐνης (aa)

SARS-CoV

306

932

601

1255

76

221

422

Σειρά CoV

302-307

923-940

506-600

1173-1452

76-108

225-262

377-454

Παράδειγμα 2Ανίχνευση του SARS-CoV σε ένα υποκείμενο

Αυτό το παράδειγμα καταδεικνύει την ανίχνευση του SARS-CoV σε δείγματα ασθενών χρησιμοποιώντας αστάρια ειδικά για SARS-CoV.

Οι ειδικοί SARS εκκινητές Cor-p-F2 (SEQ ID NO: 13), Cor-p-F3 (SEQ ID NO: 14) και Cor-p-R1 (SEQ ID NO: 15) χρησιμοποιήθηκαν για τον έλεγχο των δειγμάτων ασθενών για SARS. Ένα αστάρι για κάθε σετ σημειώθηκε με 5-άκρο με 6-FAM για να διευκολυνθεί η ανάλυση GeneScan. Οι αντιδράσεις ενίσχυσης ενός σταδίου πραγματοποιήθηκαν με το σύστημα Access RT-PCR (Promega, Madison, Wis.) Όπως περιγράφεται από τους Falsey et al., J. Infect. Dis.87: 785-90, 2003. Θετικοί και αρνητικοί μάρτυρες RT-PCR, που περιέχουν τυποποιημένα εκχυλίσματα ιικού RNA και νερό χωρίς νουκλεάση συμπεριλήφθηκαν σε κάθε δοκιμή. Τα ενισχυμένα με σήμανση 6-FAM προϊόντα αναλύθηκαν με τριχοειδή ηλεκτροφόρηση σε ABI 3100 Prism Genetic Analyzer με λογισμικό GeneScan (έκδοση 3.1.2; Applied Biosystems, Foster City, Calif.). Τα δείγματα θεωρήθηκαν θετικά για τον SARS-CoV εάν τα προϊόντα ενίσχυσης ήταν εντός ενός νουκλεοτιδίου του αναμενόμενου μεγέθους προϊόντος (368 νουκλεοτίδια για Cor-p-F2 ή Cor-p-R1 και 348 νουκλεοτίδια για Cor-p-F3 ή Cor-p- R1) και για τα δύο ειδικά σετ εκκινητών, όπως επιβεβαιώθηκε με μια δεύτερη αντίδραση PCR από άλλο κλάσμα εκχυλίσματος RNA σε ξεχωριστό εργαστήριο. Όπου η απόδοση DNA ήταν επαρκής, τα ενισχυμένα προϊόντα επίσης αλληλουχήθηκαν. Επιπλέον, όπως περιγράφηκε παραπάνω,PNAS 99: 15687-92, 2002 και Bohlander et al., Genomics 13: 1322-24, 1992).

Παράδειγμα 3Ανοσοϊστοχημική και Ιστοπαθολογική Ανάλυση και Ηλεκτρονική-Μικροσκοπική Ανάλυση Βρογχοκυψελιδικού υγρού πλύσης

Αυτό το παράδειγμα απεικονίζει ανοσοϊστοχημική, ιστοπαθολογική και ηλεκτρονική μικροσκοπική ανάλυση κυττάρων Vero E6 που έχουν μολυνθεί με τον SARS-CoV και δείγματα ιστών από ασθενείς με SARS.

Τα σταθεροποιημένα με φορμαλίνη, ενσωματωμένα σε παραφίνη κύτταρα Vero E6 μολυσμένα με τον SARS-CoV και οι ιστοί που ελήφθησαν από ασθενείς με SARS βάφτηκαν με αιματοξυλίνη και ηωσίνη και διάφορους ανοσοϊστοχημικούς λεκέδες. Οι ανοσοϊστοχημικές δοκιμασίες βασίστηκαν σε μια μέθοδο που περιγράφηκε προηγουμένως για τον hantavirus (Zaki et al., Amer. J. Pathol. 146: 552-79, 1995). Εν συντομία, τμήματα 4 μm αποπαραφινίστηκαν, επανυδατώθηκαν και αφομοιώθηκαν σε πρωτεϊνάση Κ για 15 λεπτά. Οι πλάκες επωάστηκαν στη συνέχεια για 60 λεπτά σε θερμοκρασία δωματίου με μονοκλωνικά αντισώματα, πολυκλωνικό αντιορό ή ασκιτικά υγρά που προέρχονται από ζωικά είδη με αντιδραστικότητα σε διάφορους γνωστούς κορωνοϊούς και με δείγμα ορού ανάρρωσης φάσης από ασθενή με SARS.

Οι βέλτιστες αραιώσεις των πρωτογενών αντισωμάτων προσδιορίστηκαν με πειράματα τιτλοδότησης με κύτταρα μολυσμένα με κορωνοϊό από ασθενείς με SARS και με μη μολυσμένα κύτταρα ή, όταν είναι διαθέσιμα, με συγκεντρώσεις που συνιστώνται από τους κατασκευαστές. Μετά από διαδοχική εφαρμογή του κατάλληλου βιοτινυλιωμένου αντισώματος συνδέσμου, σύμπλοκο αβιδίνης-αλκαλικής φωσφατάσης και κόκκινου υποστρώματος ταχείας ναφθόλης, τα τμήματα αντισταθερώθηκαν στην αιματοξυλίνη του Mayer και τοποθετήθηκαν με υδατικό μέσο στερέωσης. Χρησιμοποιήθηκαν οι ακόλουθοι έλεγχοι αντισωμάτων και ιστών: δείγματα ορού από μη μολυσμένα ζώα, διάφορες κυτταρικές καλλιέργειες και ζωικούς ιστούς μολυσμένους με κορωνοϊό, μη μολυσμένες κυτταρικές καλλιέργειες και φυσιολογικούς ιστούς ανθρώπων και ζώων. Οι ιστοί ασθενών δοκιμάστηκαν επίσης με ανοσοϊστοχημικές δοκιμασίες για διάφορα άλλα ιικά και βακτηριακά πνευμονικά παθογόνα. Επιπλέον,

Οι ιστοί του πνεύμονα λήφθηκαν από την αυτοψία τριών ασθενών και με ανοικτή βιοψία πνεύμονα ενός ασθενούς, 14-19 ημέρες μετά την εμφάνιση των συμπτωμάτων του SARS. Επιβεβαιωτικά εργαστηριακά στοιχεία μόλυνσης με κορονοϊό ήταν διαθέσιμα για δύο ασθενείς (ασθενείς 6 και 17) και περιλάμβαναν ενίσχυση PCR νουκλεϊκών οξέων από κορώνα από ιστούς, ιική απομόνωση από το υγρό BAL ή ανίχνευση αντισωμάτων ορού που αντιδρούν με τον κορονοϊό (Πίνακας 1). Για δύο ασθενείς, κανένα δείγμα δεν ήταν διαθέσιμο για μοριακή, κυτταρική καλλιέργεια ή ορολογική ανάλυση. Ωστόσο, και οι δύο ασθενείς πληρούσαν τον ορισμό του CDC για πιθανές περιπτώσεις SARS και είχαν ισχυρούς επιδημιολογικούς δεσμούς με εργαστηριακά επιβεβαιωμένα περιστατικά SARS. Η ιστοπαθολογική αξιολόγηση των πνευμονικών ιστών των τεσσάρων ασθενών έδειξε διάχυτη κυψελιδική βλάβη σε διάφορα επίπεδα εξέλιξης και σοβαρότητας.ΣΥΚΟ. 5Α). Άλλα ευρήματα που εντοπίστηκαν σε ορισμένους ασθενείς περιελάμβαναν εστιακή ενδοκοιλιακή αιμορραγία, νεκρωτικά φλεγμονώδη συντρίμμια στους μικρούς αεραγωγούς και οργάνωση πνευμονίας. Τα πολυπύρηνα συγκυτιακά κύτταρα εντοπίστηκαν στους ενδοκυττάριους χώρους δύο ασθενών που πέθαναν 14 και 17 ημέρες, αντίστοιχα, μετά την έναρξη της ασθένειας. Αυτά τα κύτταρα περιείχαν άφθονο κενοποιημένο κυτταρόπλασμα με σπασμένους και συσπειρωμένους πυρήνες. Δεν εντοπίστηκαν προφανή ενδοπυρηνικά ή ενδοκυτταροπλασματικά ιικά εγκλείσματα (ΣΥΚΟ. 5Β), και η ηλεκτρονική-μικροσκοπική εξέταση ενός περιορισμένου αριθμού αυτών των συγκυτικών κυττάρων δεν αποκάλυψε σωματίδια κορονοϊού. Δεν προσδιορίστηκε οριστική ανοσοχρώση σε ιστούς από ασθενείς με SARS με τη χρήση μιας μπαταρίας ανοσοϊστοχημικών λεκέδων αντιδραστικών με κορωνοϊούς από αντιγονικές ομάδες Ι, ΙΙ και ΙΙΙ. Επιπλέον, δεν εντοπίστηκε χρώση ιστών ασθενών με τη χρήση ανοσοϊστοχημικών λεκέδων για ιούς γρίπης Α και Β, αδενοϊούς, ιούς Hendra και Nipah, ανθρώπινο μεταπνευμοϊό, αναπνευστικό συγκυτιακό ιό, ιό ιλαράς, Mycoplasma pneumoniae και Chlamydia pneumoniae.

Η αξιολόγηση των κυττάρων Vero E6 που έχουν μολυνθεί με κορωνοϊό απομονωμένα από ασθενή με SARS αποκάλυψε ιογενή CPE που περιλάμβανε περιστασιακά πολυπύρηνα συγκυτιακά κύτταρα αλλά χωρίς εμφανή ιικά εγκλείσματα (ΣΥΚΟ. 5C). Ανοσοϊστοχημικές δοκιμασίες με διάφορα αντισώματα αντιδραστικά με κορωνοϊούς από αντιγονική ομάδα Ι, συμπεριλαμβανομένων των HCoV-229E, FIPV και TGEV, και με δείγμα ανοσοποιητικού ορού από ασθενή με SARS, έδειξαν ισχυρή κυτταροπλασματική και μεμβρανώδη χρώση μολυσμένων κυττάρων (ΣΥΚΟ. 5Cκαι Πίνακας 3). Ωστόσο, δεν παρατηρήθηκε διασταυρούμενη αντιδραστικότητα με το ίδιο ανοσολογικό δείγμα ανθρώπινου ορού και αντιγόνο FIPV. Δεν εντοπίστηκε χρώση με κανένα από τα πολλά μονοκλωνικά ή πολυκλωνικά αντισώματα που αντιδρούν με κορωνοϊούς στην αντιγονική ομάδα II (HCoV-OC43, BCoV και MHV) ή στην ομάδα III (TCoV και IBV-Avian). Ηλεκτρονική μικροσκοπική εξέταση ενός υγρού BAL από έναν ασθενή αποκάλυψε πολλά κύτταρα μολυσμένα με κορονοϊό (ΣΧΕΔΙΑ 6Α-Β).

ΠΙΝΑΚΑΣ 3

Ανοσοϊστοχημικές αντιδραστικότητες διαφόρων πολυκλωνικών ομάδων αντι-

δείγματα αντιορού αναφοράς κορωνοϊού με κορωνοϊό απομονωμένο από

ασθενής με SARS και με επιλεγμένους αντιγονικούς κοροναϊούς της ομάδας Ι.

Ανοσοϊστοχημική αντιδραστικότητα αντιορού με

κύτταρα καλλιέργειας μολυσμένα με κορωνοϊό

HCoV-229E

SARS-CoV

(ποντίκι 3T3-

FIPV-1

Αντιορός

(Αληθινό Ε6)

hAPN)

(BHK-fAPN)

Αναρρωνύων-

+

+

φάση SARS

(ασθενής 3)

Guinea pig anti-

+

+

HCoV-229E

Κουνέλι αντι

+

+

+

HCoV-229E

Feline anti-FIPV-

+

+

+

1

Αντι-χοίρων

+

+

TGEV

Παράδειγμα 4Ορολογική ανάλυση SARS-CoV

Αυτό το παράδειγμα απεικονίζει αντιπροσωπευτικές μεθόδους εκτέλεσης ορολογικής ανάλυσης του SARS-CoV.

Οι αντικειμενοφόρες πλάκες παρασκευάστηκαν με την εφαρμογή 15 μl του εναιωρήματος των ακτινοβολημένων με γάμμα μικτών μολυσμένων και μη μολυσμένων κυττάρων σε πλακίδια επικαλυμμένα με τεφλόν 12 φρεατίων. Οι πλάκες αφέθηκαν να στεγνώσουν στον αέρα πριν στερεωθούν σε ακετόνη. Οι αντικειμενοφόροι πλάκες στη συνέχεια αποθηκεύτηκαν στους −70 ° C μέχρι να χρησιμοποιηθούν για δοκιμές IFA (Wulff and Lange, Bull. WHO 52: 429-36, 1975). Ένα αντιγόνο ELISA παρασκευάστηκε με εκχύλιση απορρυπαντικού και επακόλουθη γάμμα ακτινοβολία μολυσμένων κυττάρων Vero Ε6 (Ksiazek et al., J. Infect. Dis.179 (συμπληρωματικό 1): S191-8, 1999). Η βέλτιστη αραίωση (1: 1000) για τη χρήση αυτού του αντιγόνου προσδιορίστηκε με τιτλοδότηση σκακιού έναντι ορού ασθενούς SARS από τη φάση ανάρρωσης. ένα αντιγόνο ελέγχου, παρασκευασμένο ομοίως από μη μολυσμένα κύτταρα Vero Ε6, χρησιμοποιήθηκε για τον έλεγχο της ειδικής αντιδραστικότητας των δοκιμασμένων ορών. Τα συζυγή που χρησιμοποιήθηκαν ήταν αιγοειδή αντι -ανθρώπινα IgG, IgA και IgM συζευγμένα με ισοθειοκυανική φθοριοσκεΐνη και υπεροξειδάση χρένου (Kirkegaard and Perry, Gaithersburg, Md.), Για τη δοκιμή IFA και ELISA, αντίστοιχα. Η ειδικότητα και η διασταυρούμενη αντιδραστικότητα μιας ποικιλίας δειγμάτων ορού στον πρόσφατα αναγνωρισμένο ιό αξιολογήθηκαν χρησιμοποιώντας τις δοκιμές που περιγράφονται εδώ. Για την αξιολόγηση αυτή, χρησιμοποιήθηκε ορός από ασθενείς με SARS στη Σιγκαπούρη, την Μπανγκόκ και το Χονγκ Κονγκ,

Οι αντικειμενοφόρες πλάκες με μολυσμένα κύτταρα αντέδρασαν με ορό από ασθενείς με πιθανό SARS στη φάση της ανάρρωσης (ΣΥΚΟ. 1Β). Η εξέταση ενός πάνελ ορού από ασθενείς με υποψία SARS από το Χονγκ Κονγκ, την Μπανγκόκ, τη Σιγκαπούρη καθώς και τις Ηνωμένες Πολιτείες έδειξε υψηλό επίπεδο ειδικής αντίδρασης με μολυσμένα κύτταρα και μετατροπή από αρνητική σε θετική αντιδραστικότητα ή διαγνωστικές αυξήσεις στο τεστ IFA από συντελεστής τεσσάρων. Ομοίως, οι δοκιμές αυτών των ίδιων δειγμάτων ορού με το αντιγόνο ELISA έδειξαν υψηλό ειδικό σήμα στα δείγματα φάσης ανάρρωσης και μετατροπή από αρνητική σε θετική αντιδραστικότητα αντισωμάτων ή διαγνωστικές αυξήσεις στον τίτλο (Πίνακας 4).

ΠΙΝΑΚΑΣ 4

Αποτελέσματα ορολογικού ελέγχου τόσο με δοκιμασία IFA όσο και με ELISA σε SARS

ασθενείς που δοκιμάστηκαν έναντι του νέου απομονωμένου ανθρώπινου κορωνοϊού.

Ορρός

Ημέρες Μετά

Πηγή

Οχι.

Επίθεση

Τίτλος ELISA*

Τίτλος IFA*

Χονγκ Κονγκ

1.1

4

<100

<25

Χονγκ Κονγκ

1.2

13

≧6400

1600

Χονγκ Κονγκ

2.1

11

400

100

Χονγκ Κονγκ

2.2

16

1600

200

Χονγκ Κονγκ

3.1

7

<100

<25

Χονγκ Κονγκ

3.2

17

≧6400

800

Χονγκ Κονγκ

4.1

8

<100

<25

Χονγκ Κονγκ

4.2

13

1600

50

Χονγκ Κονγκ

5.1

10

100

<25

Χονγκ Κονγκ

5.2

17

≧6400

1600

Χονγκ Κονγκ

6.1

12

1600

200

Χονγκ Κονγκ

6.2

20

≧6400

6400

Χονγκ Κονγκ

7.1

17

400

50

Χονγκ Κονγκ

7.2

24

≧6400

3200

Χονγκ Κονγκ

8.1

3

<100

<25

Χονγκ Κονγκ

8.2

15

≧6400

200

Χονγκ Κονγκ (Ανόι)

9.1

5

<100

<25

Χονγκ Κονγκ

9.2

11

≧6400

1600

Μπανγκόκ

1.1

2

<100

<25

Μπανγκόκ

1.2

4

<100

<25

Μπανγκόκ

1.3

7

<100

<25

Μπανγκόκ

1.4

15

1600

200

Ηνωμένες Πολιτείες

1.1

2

<100

<25

Ηνωμένες Πολιτείες

1.2

6

400

50

Ηνωμένες Πολιτείες

1.3

13

≧6400

800

Σιγκαπούρη

1.1

2

100

<25

Σιγκαπούρη

1.2

11

≧6400

800

Σιγκαπούρη

2.1

6

100

<25

Σιγκαπούρη

2.2

25

≧6400

400

Σιγκαπούρη

3.1

6

100

<25

Σιγκαπούρη

3.2

14

≧6400

400

Σιγκαπούρη

4.1

5

100

<25

Σιγκαπούρη

4.2

16

1600

400

*Αμοιβαία αραίωση

Πληροφορίες από τον περιορισμένο αριθμό δειγμάτων που ελέγχθηκαν υποδηλώνουν ότι το αντίσωμα ανιχνεύεται πρώτα με δοκιμασία IFA και ELISA μεταξύ μιας και δύο εβδομάδων μετά την εμφάνιση των συμπτωμάτων στον ασθενή. Η δοκιμή IFA και η ELISA μιας ομάδας 384 τυχαία επιλεγμένων δειγμάτων ορού (από αιμοδότες ΗΠΑ) ήταν αρνητικά για αντισώματα στον νέο κορονοϊό, με εξαίρεση ένα δείγμα που είχε ελάχιστη δραστικότητα στο ELISA. Μια ομάδα ζευγαρωμένων δειγμάτων ανθρώπινου ορού με διαγνωστικές αυξήσεις (κατά τέσσερις ή περισσότερες φορές) στο αντίσωμα (με πολύ υψηλούς τίτλους στο ομόλογο ιικό αντιγόνο στον ορό ανάρρωσης) στους δύο γνωστούς ανθρώπινους κορωνοϊούς, OC43 (13 ζεύγη) και 229E (14 ζευγάρια), δεν έδειξαν αντιδραστικότητα σε ορό οξείας ή ανάρρωσης φάσης με τον πρόσφατα απομονωμένο κορωνοϊό είτε με τη δοκιμή IFA είτε με τον ELISA.

Παράδειγμα 5Poly (A) + RNA Απομόνωση και Northern Hybridization

Αυτό το παράδειγμα απεικονίζει μια αντιπροσωπευτική μέθοδο υβριδοποίησης Northern για την ανίχνευση μηνυμάτων SARS-CoV σε κύτταρα Vero Ε6.

Ολικό RNA από μολυσμένα ή μη μολυσμένα κύτταρα Vero E6 απομονώθηκε με αντιδραστήριο Trizol (Invitrogen Life Technologies, Carlsbad, Calif.) Που χρησιμοποιήθηκε σύμφωνα με τις συστάσεις του κατασκευαστή. Poly (A) + RNA απομονώθηκε από το ολικό RNA με τη χρήση του Oligotex Direct mRNA Kit (Qiagen, Inc., Santa Clarita, Calif.), Ακολουθώντας τις οδηγίες για το πρωτόκολλο παρτίδας, ακολουθούμενο από καταβύθιση αιθανόλης. RNA απομονώθηκε από 1 εκατοστό 2 κυττάρων διαχωρίστηκε με ηλεκτροφόρηση σε 0,9% πήκτωμα αγαρόζης που περιείχε 3,7% φορμαλδεΰδη, που ακολουθείται από μερική αλκαλική υδρόλυση (Ausubel et al. Eds. Current Protocols ίη Molecular Biology, τόμ. 1, John Wiley & Sons, Inc., NY, NY, Ch. 4.9, 1996). Το RNA μεταφέρθηκε σε νάιλον μεμβράνη (Roche Molecular Biochemicals, Indianapolis, Ind.) Με κηλίδωση κενού (Bio-Rad, Hercules, Calif.) Και σταθεροποιήθηκε με διασταυρούμενη σύνδεση UV. Το πρότυπο DNA για σύνθεση ανιχνευτή δημιουργήθηκε με ενίσχυση RT-PCR του SARS-CoV nt 29,083 έως 29,608 (SEQ ID ΝΟ: 1), χρησιμοποιώντας αντίστροφο εκκινητή που περιέχει έναν προαγωγέα πολυμεράσης T7 RNA για να διευκολύνει τη δημιουργία ενός ριβοπρομπέτου με αρνητική αίσθηση. Η in vitro μεταγραφή του επισημασμένου με διγοξυγενίνη ριβοπροειδοποιητή, ο υβριδισμός και ο εντοπισμός των ζωνών πραγματοποιήθηκαν με το σύστημα διγοξιγενίνης χρησιμοποιώντας διαδικασίες που συνιστούσαν οι κατασκευαστές (Roche Molecular Biochemicals, Indianapolis, Ind.). Τα σήματα οπτικοποιήθηκαν με χημειοφωταύγεια και ανιχνεύθηκαν με φιλμ ακτίνων Χ.

Παράδειγμα 6Οργανισμός γονιδιώματος SARS-CoV

Αυτό το παράδειγμα απεικονίζει τη γονιδιωματική οργάνωση του γονιδιώματος SARS-CoV, συμπεριλαμβανομένης της θέσης των ORFs SARS-CoV.

Το γονιδίωμα του SARS-CoV είναι ένα 29,727-νουκλεοτίδιο, πολυαδενυλιωμένο RNA και το 41% ​​των υπολειμμάτων είναι G ή C (εύρος για δημοσιευμένες πλήρεις αλληλουχίες γονιδιώματος του κορονοϊού, 37% έως 42%). Η γονιδιωματική οργάνωση είναι τυπική των κορωνοϊών, με τη χαρακτηριστική γονιδιακή τάξη [5′-ρεπλικάση (rep), ακίδα (S), φάκελος (E), μεμβράνη (M), νουκλεοκαψίδιο (N) -3 ′] και σύντομες αμετάφραστες περιοχές σε και τα δύο τερματικά (ΣΥΚΟ. 7Α, Πίνακας 5). Το γονίδιο rep SARS-CoV, το οποίο περιλαμβάνει περίπου τα δύο τρίτα του γονιδιώματος, κωδικοποιεί δύο πολυπρωτεΐνες (κωδικοποιημένες με ORF1a και ORF1b) που υποβάλλονται σε συν-μεταφραστική πρωτεολυτική επεξεργασία. Υπάρχουν τέσσερα ORFs κατάντια του rep που κωδικοποιούν τις δομικές πρωτεΐνες, S, E, M και N, οι οποίες είναι κοινές σε όλους τους γνωστούς κορωνοϊούς. Το γονίδιο αιμαγλουτινίνης-εστεράσης, το οποίο υπάρχει μεταξύ των ORF1b και S στην ομάδα 2 και ορισμένους κοροναϊούς της ομάδας 3 (Lai and Holmes, in Fields Virology , eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4th edition, 2001, Κεφ. 35), δεν βρέθηκε στο SARS-CoV.

Οι κορονοϊοί κωδικοποιούν επίσης έναν αριθμό μη δομικών πρωτεϊνών που βρίσκονται μεταξύ S και E, μεταξύ M και N ή κατάντη του Ν. Αυτές οι μη δομικές πρωτεΐνες, οι οποίες ποικίλλουν ευρέως μεταξύ των διαφόρων ειδών κορωνοϊού, είναι άγνωστης λειτουργίας και είναι αναλώσιμες για αντιγραφή ιών (Lai and Holmes, in Fields Virology , eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4 th edition, 2001, Ch. 35). Το γονιδίωμα του SARS-CoV περιέχει ORF για πέντε μη δομικές πρωτεΐνες άνω των 50 αμινοξέων (ΣΥΚΟ. 7Β, Πίνακας 5). Δύο αλληλεπικαλυπτόμενα ORF που κωδικοποιούν πρωτεΐνες 274 και 154 αμινοξέων (που ονομάζονται X1 (SEQ ID ΝΟ: 5) και X2 (SEQ ID ΝΟ: 6), αντίστοιχα) βρίσκονται μεταξύ S (SEQ ID NO: 4) και E (SEQ ID NO : 7). Τρία επιπλέον μη δομικά γονίδια, X3 (SEQ ID ΝΟ: 9), X4 (SEQ ID ΝΟ: 10) και X5 (SEQ ID ΝΟ: 11) (κωδικοποιώντας πρωτεΐνες 63, 122 και 84 αμινοξέων, αντίστοιχα), βρίσκονται μεταξύ Μ (SEQ ID ΝΟ: 8) και Ν (SEQ ID ΝΟ: 12). Εκτός από τα πέντε ORF που κωδικοποιούν τις μη δομικές πρωτεΐνες που περιγράφονται παραπάνω, υπάρχουν επίσης δύο μικρότερα ORFs μεταξύ Μ και Ν, που κωδικοποιούν πρωτεΐνες μικρότερες από 50 αμινοξέα. Οι αναζητήσεις στη βάση δεδομένων GenBank (BLAST και FastA) έδειξαν ότι δεν υπάρχει σημαντική ομοιότητα αλληλουχίας μεταξύ αυτών των μη δομικών πρωτεϊνών του SARS-CoV και οποιωνδήποτε άλλων πρωτεϊνών.

Τα προϊόντα γονιδίου rep του κορωνοϊού μεταφράζονται από γονιδιωματικό RNA, αλλά οι υπόλοιπες ιικές πρωτεΐνες μεταφράζονται από υπογονιδιωματικά mRNA που σχηματίζουν ένα ένθετο σετ 3′-συν-τελικού, το καθένα με 5′-άκρο που προέρχεται από τη γονιδιωματική ακολουθία 5′-οδηγού. Τα υπογονιδιωματικά mRNA του κορονοϊού συντίθενται μέσω μιας ασυνεχούς διαδικασίας μεταγραφής, ο μηχανισμός της οποίας δεν έχει καθοριστεί κατηγορηματικά (Lai and Holmes, in Fields Virology , eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4th edition, 2001, Ch. 35 · Sawicki and Sawicki, Adv. Exp. Med. Biol.440: 215-19, 1998). Η αλληλουχία οδηγού SARS-CoV χαρτογραφήθηκε συγκρίνοντας την αλληλουχία προϊόντων 5′-RACE που συντέθηκαν από το mRNA γονιδίου Ν με αυτά που συντέθηκαν από γονιδιωματικό RNA. Μια αλληλουχία, AAACGAAC (νουκλεοτίδια 65-72 της SEQ ID ΝΟ: 1), ταυτοποιήθηκε αμέσως ανάντη της θέσης όπου αποκλίνουν το mRNA του γονιδίου Ν και οι γονιδιωματικές αλληλουχίες. Αυτή η αλληλουχία ήταν επίσης παρούσα ανάντη του ORF1a και αμέσως ανάντη πέντε άλλων ORF (Πίνακας 5), υποδηλώνοντας ότι λειτουργεί ως ο διατηρημένος πυρήνας της μεταγραφικής ρυθμιστικής αλληλουχίας (TRS).

Εκτός από τη θέση στο 5′-άκρο του γονιδιώματος, η διατηρημένη ακολουθία TRS εμφανίζεται έξι φορές στο υπόλοιπο του γονιδιώματος. Οι θέσεις του TRS στο γονιδίωμα του SARS-CoV προβλέπουν ότι πρέπει να παραχθούν υπογονιδιωματικά mRNA των 8,3, 4,5, 3,4, 2,5, 2,0 και 1,7 kb, χωρίς να περιλαμβάνεται η πολυ (Α) ουρά (ΣΧΕΔΙΑ 7Α-Β, Πίνακας 5). Τουλάχιστον πέντε υπογονιδιωματικά mRNA ανιχνεύθηκαν με υβριδισμό Northern του RNA από κύτταρα μολυσμένα με SARS-CoV, χρησιμοποιώντας έναν ανιχνευτή που προήλθε από την 3′-αμετάφραστη περιοχή (ΣΥΚΟ. 7C). Τα υπολογισμένα μεγέθη των πέντε κυρίαρχων ζωνών αντιστοιχούν στα μεγέθη των πέντε από τα προβλεπόμενα υπογονιδιωματικά mRNAs του SARS-CoV. δεν αποκλείεται η πιθανότητα να υπάρχουν άλλα mRNA χαμηλής αφθονίας. Σε αναλογία με άλλους κορωνοϊούς (Lai and Holmes, in Fields Virology , eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4 thέκδοση, 2001, Κεφ. 35), τα υπογονιδιωματικά mRNA των 8,3-kb και 1,7-kb είναι μονοκιστρονικά, οδηγώντας τη μετάφραση των S και N, αντίστοιχα, ενώ πολλαπλές πρωτεΐνες μεταφράζονται από τα 4,5-kb (X1, X2 και E), 3,4-kb (M και X3) και mRNA 2,5-kb (Χ4 και Χ5). Δεν υπάρχει συναίνεση TRS απευθείας ανάντη του ORF που κωδικοποιεί την προβλεπόμενη Ε πρωτεΐνη, και ένα μονοκιστρονικό mRNA που προβλέπεται ότι θα κωδικοποιήσει το Ε δεν θα μπορούσε να προσδιοριστεί με σαφή ανάλυση Northern blot. Είναι πιθανό ότι η ζώνη 3,6-kb περιέχει περισσότερα από ένα είδη mRNA ή ότι το μονοκιστρονικό mRNA για το Ε είναι ένα μήνυμα χαμηλής αφθονίας.

ΠΙΝΑΚΑΣ 5

Θέσεις ORFs SARS-CoV και μεγέθη πρωτεϊνών και mRNA

Τοποθεσία γονιδιώματος

Προβλεπόμενο Μέγεθος

ORF

TRS α

Έναρξη ORF

ORF Τέλος

Πρωτεΐνη (αα)

mRNA (nt) β

72

265

13,398

4,378

29,727

13,398

21,482

2,695

μικρό

21,491

21,492

25,256

1,255

8,308 γ

Χ1

25,265

25,268

26,089

274

4.534 γ

Χ2

25,689

26,150

154

ΚΑΙ

26,117

26,344

76

Μ

26,353

26,398

27,060

221

3,446 γ

X3

27,074

27,262

63

X4

27,272

27,273

27,638

122

2.527 αι

Χ5

27,778

27,864

28,115

84

2.021 δ

Ν

28,111

28,120

29,385

422

1.688 γ

a Η τοποθεσία είναι το 3′-περισσότερο νουκλεοτίδιο στο συναίνετο TRS, AAACGAAC.

β Δεν περιλαμβάνει το πολυ (Α). Το προβλεπόμενο μέγεθος βασίζεται στη θέση του διατηρημένου TRS.

c Αντίστοιχο mRNA ανιχνεύθηκε με ανάλυση στυπώματος Northern (ΕΙΚ. 7C)

d Δεν ανιχνεύθηκε mRNA που αντιστοιχεί στη χρήση αυτής της συναίνεσης TRS με ανάλυση στυπώματος Northern (ΕΙΚ. 7C)

Παράδειγμα 7Δοκιμή RT-PCR σε πραγματικό χρόνο για ανίχνευση SARS-CoV

Αυτό το παράδειγμα καταδεικνύει τη χρήση εκκινητών και ανιχνευτών ειδικών για τον SARS-CoV σε δοκιμασία RT-PCR σε πραγματικό χρόνο για την ανίχνευση του SARS-CoV σε δείγματα ασθενών.

Μια παραλλαγή της μορφής σε πραγματικό χρόνο, βασισμένη στην τεχνολογία υδρόλυσης του ανιχνευτή TaqMan (Applied Biosystems, Foster City, Calif.), Χρησιμοποιήθηκε για την ανάλυση συνολικά 340 κλινικών δειγμάτων που συλλέχθηκαν από 246 άτομα με επιβεβαιωμένη ή υποψία μόλυνσης SARS-CoV. Τα δείγματα περιλάμβαναν στοματο-ρινοφαρυγγικά επιχρίσματα (ξηρά και σε ιογενή μέσα μεταφοράς), πτύελα, ρινικές αναρροφήσεις και πλύσεις, BAL και δείγματα ιστού πνεύμονα που συλλέχθηκαν κατά την αυτοψία.

Εκχύλιση νουκλεϊκού οξέος

Τα νουκλεϊκά οξέα SARS-CoV ανακτήθηκαν από κλινικά δείγματα χρησιμοποιώντας το αυτοματοποιημένο σύστημα εξαγωγής NucliSens (bioMérieux, Durham, NC). Ακολουθώντας τις οδηγίες του κατασκευαστή, τα δείγματα που ελήφθησαν σε ρυθμιστικό διάλυμα λύσης NucliSens επωάστηκαν στους 37 ° C για 30 λεπτά με διαλείπουσα ανάμειξη και προστέθηκαν και αναμίχθηκαν 50 μL εναιωρήματος πυριτίας, που παρέχονται στο κιτ εκχύλισης. Το περιεχόμενο του σωλήνα στη συνέχεια μεταφέρθηκε σε φυσίγγιο εκχύλισης νουκλεϊκού οξέος και υποβλήθηκε σε επεξεργασία σε έναν σταθμό εργασίας εξαγωγέα. Περίπου 40-50 μL ολικού εκλούσματος νουκλεϊκού οξέος ανακτήθηκαν σε φιαλίδια χωρίς νουκλεάση και είτε δοκιμάστηκαν αμέσως είτε φυλάχθηκαν στους −70 ° C.

Αστάρια και ανιχνευτές

Πολλαπλά σετ εκκινητών και ανιχνευτών σχεδιάστηκαν από τις αλληλουχίες SARS-CoV πολυμεράσης 1b (νουκλεϊκό οξύ 13,398 έως 21,482 της SEQ ID ΝΟ: 1) και γονιδίου νουκλεοκαψιδίου (νουκλεϊκό οξύ 28,120 έως 29,385 SEQ ID ΝΟ: 1) χρησιμοποιώντας την έκδοση λογισμικού Primer Express 1.5 ή 2.0.0 (Applied Biosystems, Foster City, Calif.) Με τις ακόλουθες προεπιλεγμένες ρυθμίσεις: θερμοκρασία τήξης αστάρι (Τ Μ ) ρυθμισμένη στους 60 ° C. ανιχνευτής Τ Μρυθμισμένο στους 10 ° C μεγαλύτερο από τα αστάρια στους 70 ° C περίπου. και δεν επιτρέπονται κατάλοιπα γουανιδίνης στα άκρα του ανιχνευτή 5 “. Όλοι οι εκκινητές και οι ανιχνευτές συντέθηκαν με πρότυπες τεχνικές χημείας φωσφοραμιδίτη. Οι ανιχνευτές TaqMan επισημάνθηκαν στο 5′-άκρο με το ρεπόρτερ 6-FAM και στο 3′-άκρο με το σβήσιμο Blackhole Quencher 1 (Biosearch Technologies, Inc., Novato, Καλιφόρνια). Οι βέλτιστες συγκεντρώσεις εκκινητή και ανιχνευτή προσδιορίστηκαν με διασταυρούμενη τιτλοποίηση σειριακών διπλών αραιώσεων κάθε εκκινητή έναντι σταθερής ποσότητας καθαρισμένου RNA SARS-CoV. Οι συγκεντρώσεις εκκινητή και ανιχνευτή που έδωσαν τις υψηλότερες αποδόσεις ενίσχυσης επιλέχθηκαν για περαιτέρω μελέτη (Πίνακας 6).

ΠΙΝΑΚΑΣ 6

Εκκινητές και ανιχνευτές που χρησιμοποιούνται για δοκιμές RT-PCR σε πραγματικό χρόνο α

Γονιδιωματική

Αναγνωριστικό ανάλυσης

Αστάρι / καθετήρας

Αλληλουχία

Περιοχή

Πρωτογενής διαγνωστική δοκιμασία

SARS1

φά

CATGTGTGGCGGCTCACTATAT (SEQ ID NO: 16)

RNA Πολ

R

GACACTATTAGCATAAGCAGTTGTAGCA (ΑΡΙΘΜ. ΑΡ. ΤΑΥΤ .: 17)

P

TTAAACCAGGTGGAACATCATCCGGTG (SEQ ID NO: 18)

SARS2

φά

GGAGCCTTGAATACACCCAAAG (ΑΡ. ΤΑΥΤ. ΑΡΙΘ. 19)

Νουκλεοκαψίδιο

R

GCACGGTGGCAGCATTG (ΑΡ. ΤΑΥΤ. ΑΡΙΘ. 20)

P

CCACATTGGCACCCGCAATCC (SEQ ID NO: 21)

SARS3

φά

CAAACATTGGCCGCAAATT (ΑΡΙΘΜ. ΑΡ. ΤΑΥΤ .: 22)

Νουκλεοκαψίδιο

R

CAATGCGTGACATTCCAAAGA (ΑΡ. ΤΑΥΤ. ΑΡΙΘ. 23)

P

CACAATTTGCTCCAAGTGCCTCTGCA (SEQ ID NO: 24)

Για επιβεβαίωση θετικών αποτελεσμάτων

N3

φά

GAAGTACCATCTGGGGCTGAG (SEQ ID NO: 25)

Νουκλεοκαψίδιο

R

CCGAAGAGCTACCCGACG (SEQ ID NO: 26)

P

CTCTTTCATTTTGCCGTCACCACCAC (SEQ ID NO: 27)

3′-NTR

φά

AGCTCTCCCTAGCATTATTCACTG (ΑΡ. ΤΑΥΤ. ΑΡΙΘ. 28)

3′-NTR

R

CACCACATTTCATCGAGGC (SEQ ID NO: 29)

P

TACCCTCGATCGTACTCCGCGT (SEQ ID NO: 30)

Μ

φά

TGTAGGCACTGATTCAGGTTTTG (ΑΡ. ΤΑΥΤ. ΑΡΙΘ. 31)

Πρωτεΐνη Μ

R

CGGCGTGGTCTGTATTTAATTTA (SEQ ID NO: 32)

P

CTGCATACAACCGCTACCGTATTGGAA (ΑΚΟΛ. ΑΡ. ΤΑΥΤ .: 33)

μια RT-PCR, αντίστροφη αλυσιδωτή αντίδραση μεταγραφής-πολυμεράσης. F, εμπρός αστάρι. R, αντίστροφο αστάρι. Ρ, ανιχνευτής; NTR, μη μεταφρασμένη περιοχή.

Δοκιμασία RT-PCR σε πραγματικό χρόνο

Η δοκιμασία RT-PCR σε πραγματικό χρόνο πραγματοποιήθηκε χρησιμοποιώντας το Real-Time One-Step RT-PCR Master Mix (Applied Biosystems, Foster City, Calif.). Κάθε μίγμα αντίδρασης των 25 μL περιείχε 12,5 μL 2 × Master Mix, 0,625 μL του μίγματος 40 × MultiScribe και RNase Inhibitor, 0,25 μL ανιχνευτή 10 μM, 0,25 μL έκαστο των 50 μM εμπρός και αντίστροφων εκκινητών, 6,125 μL νουκλεάσης- ελεύθερο νερό και 5 μL εκχύλισμα νουκλεϊκού οξέος. Η ενίσχυση πραγματοποιήθηκε σε πλάκες 96 φρεατίων σε ένα σύστημα ανίχνευσης iCycler iQ σε πραγματικό χρόνο (Bio-Rad, Hercules, Calif.). Οι συνθήκες θερμοκυκλοφορίας αποτελούνταν από 30 λεπτά στους 48 ° C για αντίστροφη μεταγραφή, 10 λεπτά στους 95 ° C για ενεργοποίηση της πολυμεράσης AmpliTaq Gold DNA και 45 κύκλους 15 δευτερολέπτων στους 95 ° C και 1 λεπτό στους 60 ° C. Κάθε εκτέλεση περιελάμβανε έναν έλεγχο γονιδιωματικού προτύπου SARS-CoV και τουλάχιστον δύο ελέγχους χωρίς πρότυπο για την εξαγωγή (για έλεγχο για μόλυνση κατά την επεξεργασία δείγματος) και έναν έλεγχο χωρίς πρότυπο για το βήμα ενίσχυσης PCR. Ως έλεγχος για τους αναστολείς PCR και για την παρακολούθηση της αποτελεσματικότητας εκχύλισης νουκλεϊκού οξέος, κάθε δείγμα δοκιμάστηκε με RT-PCR σε πραγματικό χρόνο για την παρουσία του γονιδίου ανθρώπινης ριβονουκλεάσης (RNase) P (GenBank Accession No. NM- 006413), χρησιμοποιώντας τους ακόλουθους εκκινητές και ανιχνευτής: ορθός εκκινητής 5′-AGATTTGGACCTGCGAGCG-3 “(SEQ ID ΝΟ: 36)? αντίστροφο αστάρι 5′-GAGCGGCTGTCTCCACAAGT-3 ′ (SEQ ID ΝΟ: 37); ανιχνευτής 5′-TTCTGACC TGAAGGCTCTGCGCG-3 ′ (SEQ ID ΝΟ: 38). Η αντίδραση δοκιμασίας πραγματοποιήθηκε όμοια με εκείνη που περιγράφηκε παραπάνω εκτός από το ότι οι συγκεντρώσεις εκκινητών που χρησιμοποιήθηκαν ήταν 30 μΜ η κάθε μία. Ελήφθησαν μετρήσεις φθορισμού και υπολογίστηκε η τιμή του κύκλου κατωφλίου (C T ) για κάθε δείγμα προσδιορίζοντας το σημείο στο οποίο ο φθορισμός ξεπέρασε το όριο κατωφλίου που καθορίστηκε στο μέσο συν 10 τυπικές αποκλίσεις πάνω από την αρχική τιμή. Ένα αποτέλεσμα δοκιμής θεωρήθηκε θετικό εάν δύο ή περισσότεροι από τους γονιδιωματικούς στόχους του SARS έδειξαν θετικά αποτελέσματα ( κύκλοι C T ≦ 45) και όλες οι θετικές και αρνητικές αντιδράσεις ελέγχου έδωσαν τις αναμενόμενες τιμές.

Ενώ αυτή η αποκάλυψη έχει περιγραφεί με έμφαση στις προτιμώμενες εφαρμογές, θα είναι προφανές σε όσους έχουν συνηθισμένη εμπειρία στην τεχνική ότι μπορούν να χρησιμοποιηθούν παραλλαγές και ισοδύναμα των προτιμώμενων εφαρμογών και ότι η αποκάλυψη μπορεί να εφαρμοστεί διαφορετικά από ό, τι συγκεκριμένα περιγράφεται εδώ. Συνεπώς, αυτή η γνωστοποίηση περιλαμβάνει όλες τις τροποποιήσεις που εμπίπτουν στο πνεύμα και το πεδίο της αποκάλυψης όπως ορίζεται από τις αξιώσεις παρακάτω.

Αξιώσεις (7)

Απόκρυψη εξαρτώμενου

  1. Μέθοδος ανίχνευσης κορονοϊού που σχετίζεται με σοβαρό οξύ αναπνευστικό σύνδρομο (SARS-CoV) σε δείγμα που περιλαμβάνει:

επαφή του δείγματος με ένα ζεύγος εκκινητών νουκλεϊνικού οξέος που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV, όπου τουλάχιστον ένας εκκινητής είναι 5′-άκρων επισημασμένος με μια βαφή αναφοράς, και όπου τουλάχιστον ένας από τους εκκινητές περιλαμβάνει την ακολουθία όπως εκτίθεται σε οποιοδήποτε από τα SEQ ID NO: 13-15.

ενίσχυση του νουκλεϊκού οξέος SARS-CoV ή ενός τεμαχίου αυτού από το δείγμα που χρησιμοποιεί το ζεύγος εκκινητών νουκλεϊνικού οξέος.

ηλεκτροφόρηση των ενισχυμένων προϊόντων · και

ανίχνευση της χρωστικής ρεπόρτερ με 5-άκρες με ετικέτα, εντοπίζοντας έτσι έναν SARS-CoV.

  1. Η μέθοδος του αξίωση 1, όπου η ενίσχυση χρησιμοποιεί αλυσιδωτή αντίδραση αντίστροφης μεταγραφάσης-πολυμεράσης.

  2. Μέθοδος ανίχνευσης ενός σοβαρού κορονοϊού που σχετίζεται με οξύ αναπνευστικό σύνδρομο (SARS-CoV) σε ένα δείγμα, που περιλαμβάνει:

επαφή του δείγματος με ένα ζεύγος εκκινητών νουκλεϊνικού οξέος που υβριδοποιούνται σε ένα νουκλεϊκό οξύ SARS-CoV, όπου τουλάχιστον ένας από τους εκκινητές νουκλεϊκού οξέος περιλαμβάνει την αλληλουχία όπως εκτίθεται σε οποιοδήποτε από τα SEQ ID ΝΟ: 13-15.

ενίσχυση του νουκλεϊκού οξέος SARS-CoV ή ενός τεμαχίου αυτού από το δείγμα που χρησιμοποιεί το ζεύγος εκκινητών νουκλεϊνικού οξέος.

προσθήκη στο ενισχυμένο νουκλεϊνικό οξύ SARS-CoV ή στο θραύσμα αυτού ενός ανιχνευτή SARS-CoV που υβριδοποιείται στο νουκλεϊνικό οξύ SARS-CoV, όπου ο ανιχνευτής SARS-CoV επισημαίνεται με 5′-χρωστική ουσία αναφοράς και βαφή 3′-σβέσης ?

πραγματοποίηση ενός ή περισσότερων επιπλέον γύρων ενίσχυσης με πολυμεράση Taq DNA · και

ανίχνευση φθορισμού της χρωστικής αναφοράς 5′, ανίχνευση έτσι ενός SARS-CoV.

  1. Ένα κιτ για την ανίχνευση ενός σοβαρού κορονοϊού που σχετίζεται με οξύ αναπνευστικό σύνδρομο (SARS-CoV) σε ένα δείγμα, που περιλαμβάνει ένα ζευγάρι εκκινητών νουκλεϊκών οξέων που υβριδοποιούνται υπό αυστηρές συνθήκες σε ένα νουκλεϊκό οξύ SARS-CoV, όπου τουλάχιστον ένας από τους εκκινητές περιλαμβάνει την αλληλουχία όπως εκτίθεται σε οποιοδήποτε από τα SEQ ID ΝΟ: 13-15.

  2. Το κιτ του αξίωση 4, όπου ένα αστάρι έχει 5-άκρες επισημασμένο με χρωστική ουσία αναφοράς.

  3. Το κιτ του αξίωση 4, που περιλαμβάνει περαιτέρω έναν ανιχνευτή SARS-CoV που υβριδοποιείται στο νουκλεϊκό οξύ SARS-CoV που ενισχύεται από το ζεύγος εκκινητών, όπου ο ανιχνευτής SARS-CoV είναι επισημασμένος με 5′-χρωστική ουσία αναφοράς και βαφή 3′-σβέσης.

  4. Το κιτ του αξίωση 4, που περιλαμβάνει περαιτέρω έναν απομονωμένο οργανισμό SARS-CoV.

Παραπομπές διπλωμάτων ευρεσιτεχνίας (3)

Αριθμός έκδοσηςΗμερομηνία προτεραιότηταςΗμερομηνία έκδοσηςΕντολοδόχοςΤίτλος

WO2004092360A22003-04-102004-10-28Chiron CorporationΤο σοβαρό οξύ αναπνευστικό σύνδρομο κορωνοϊός

US20050181357A1 *2003-03-242005-08-18Peiris Joseph S.Διαγνωστική δοκιμασία υψηλής απόδοσης για τον ανθρώπινο ιό που προκαλεί σοβαρό οξύ αναπνευστικό σύνδρομο (SARS)

Παραπομπές από οικογένεια σε οικογένεια

US7375202B2 *2003-03-242008-05-20Το Πανεπιστήμιο του Χονγκ ΚονγκΑνθρώπινος ιός που προκαλεί σοβαρό οξύ αναπνευστικό σύνδρομο (SARS) και χρήσεις αυτού

* Παρατίθεται από τον εξεταστή, ited Παρατίθεται από τρίτο μέρος

Αναφορές χωρίς δίπλωμα ευρεσιτεχνίας (22)

Τίτλος

«Ενημέρωση: Έκρηξη Σοβαρού Οξέος Αναπνευστικού Συνδρόμου-Παγκόσμια, 2003,» MMWR Weekly 52: 241-248, 2003.

«Ενημέρωση: Έκρηξη Σοβαρού Οξέος Αναπνευστικού Συνδρόμου-Παγκόσμια, 2003,» MMWR Weekly 52: 241-248, 2003.

Emery et al., «Real-Time Reverse Transcription-Polymerase Chain Reaction Assay for SARS-Associated Coronavirus,» Emerg. Μολύνω. Ασθένειες 10: 311-316, 2004.

Αριθμός Πρόσβασης GenBank AY274119, 14 Απριλίου 2003.

Αριθμός Πρόσβασης Genbank AY274119.1 GI: 29826276 (14 Απριλίου 2003). *

Αριθμός πρόσβασης GenBank AY278487, 21 Απριλίου 2003.

Αριθμός πρόσβασης GenBank AY278491.1, 18 Απριλίου 2003.

Αριθμός πρόσβασης GenBank AY278554.1, 18 Απριλίου 2003.

Αριθμός Πρόσβασης GenBank AY278741, 21 Απριλίου 2003.

Goldsmith et al., «Ultrastructural Characterization of SARS Coronavirus», Emerg. Μολύνω. Ασθένειες 10: 320-326, 2004.

Gut et al (Journal of Virological Methods 77: 37-46, 1999). *

Ksiazek et al (New England Journal of Medicine 348: 1953-1966, δημοσιευμένη στο διαδίκτυο 10 Απριλίου 2003). *

Ksiazek et al., «A Novel Coronavirus Associated with σοβαρό οξύ αναπνευστικό σύνδρομο», N. Engl. J. Med. 348: 1953-1966, 2003.

Luo and Luo, «Initial SARS Coronavirus Genome Sequence Analysis Using a Bioinformatics Platform», 2nd Asia-Pacific Bioinformatics Conference (APBC2004), Dunedin, New Zealand, 2004.

Marra et al., «The Genome Sequence of the SARS-Associated Coronavirus», Science 300: 1393-1404, 2003.

Neilan et al (Nucleic Acids Research 25: 2938-9, 1997). *

Peiris et al (Lancet, 361: 1319-1325, δημοσιευμένη στο διαδίκτυο 8 Απριλίου 2003). *

Rota et al., «Χαρακτηρισμός ενός νέου κορονοϊού που σχετίζεται με το σοβαρό οξύ αναπνευστικό σύνδρομο», Science 300: 1394-1399, 2003.

Κορωνοϊός που σχετίζεται με SARS. Διαθεσιμότητα γονιδιωματικής αλληλουχίας. [online] [ανακτήθηκε στις 8 Αυγούστου 2005]. Ανακτήθηκε από το Διαδίκτυο. *

Κορωνοϊός που σχετίζεται με SARS. Διαθεσιμότητα γονιδιωματικής αλληλουχίας. [online] [ανακτήθηκε στις 8 Αυγούστου 2005]. Ανακτήθηκε από το Διαδίκτυο <URL: http://www.bcgsc.ca/bioinfo/SARS>. *

Συμπληρωματικό διαδικτυακό υλικό για Marra et al., Www.sciencemag.org/cgi/content/full/1085953/DC1, (2003).

Συμπληρωματικό διαδικτυακό υλικό για τους Rota et al., Www.sciencemag.org/cgi/content/full/1085953/DC1, (2003).

* Παρατίθεται από τον εξεταστή, ited Παρατίθεται από τρίτο μέρος

Παρατίθεται από (9)

Αριθμός έκδοσηςΗμερομηνία προτεραιότηταςΗμερομηνία έκδοσηςΕντολοδόχοςΤίτλος

RU2473702C1 *2011-11-162013-01-27Ομοσπονδιακό δημοσιονομικό ίδρυμα επιστήμης «Κρατικό Επιστημονικό Κέντρο Ιολογίας και Βιοτεχνολογίας» Διάνυσμα «» (FBSI SSC VB «Vector»)Σύνολο ολιγοδεοξυριβονουκλεοτιδικών εκκινητών και ανιχνευτών με σήμα φθορισμού για ταυτοποίηση 229e, nl63, oc43, hku1 κορωνοϊού rna με φθορισμό σε υβριδισμό επί τόπου και αντίστροφη αλυσιδωτή αντίδραση μεταγραφής-πολυμεράσης

Παραπομπές από οικογένεια σε οικογένεια

WO2004096842A2 *2003-04-282004-11-11Οργανισμός Δημόσιας Υγείας του ΚαναδάΑλληλουχίες νουκλεοτιδίου ιού Sars και αμινοξέων και χρήσεις αυτών

US8541003B2 *2003-06-202013-09-24Protein Sciences CorporationΦορείς που εκφράζουν ανοσογόνα SARS, συνθέσεις που περιέχουν τέτοιους φορείς ή προϊόντα έκφρασης αυτών, μεθόδους και δοκιμασίες για την παρασκευή και χρήση

US7709188B2 *2003-08-222010-05-04Birch Biomedical Research LlcΠολυμελλική ανίχνευση του κορονοϊού που σχετίζεται με τον SARS

JP5090741B2 *2003-12-022012-12-05Ινστιτούτο ΠαστέρΧρήση πρωτεϊνών και πεπτιδίων που κωδικοποιούνται από το γονιδίωμα νέων στελεχών του κορονοϊού που σχετίζονται με τον SARS

CN1680432B *2004-03-022011-06-15Yung shin φαρμακοβιομηχανία co., Ltd.Ιική πρωτεΐνη

US20060292178A1 *2004-08-042006-12-28Οργανισμός Επιστήμης, Τεχνολογίας και ΈρευναςΠρωτεΐνες που κωδικοποιούνται από το σοβαρό κορονοϊό οξέος αναπνευστικού συνδρόμου (SARS) και ρόλο στην απόπτωση

US20070134739A1 *2005-12-122007-06-14Gyros Patent AbΜικρορευστικές δοκιμασίες και μικρορευστικές συσκευές

US11058764B1 *2020-08-102021-07-13Timothy S. MooreΕμβόλιο HCoV για τη βελτίωση της ανοσίας έναντι της μόλυνσης SARS-CoV-2

* Παρατίθεται από τον εξεταστή, † Παρατίθεται από τρίτο μέρος, cit Παραπομπή από οικογένεια σε οικογένεια

Παρόμοια έγγραφα

ΔημοσίευσηΗμερομηνία έκδοσηςΤίτλος

US7776521B12010-08-17Κορωνοϊός απομονωμένος από ανθρώπους

US20210246431A12021-08-12Human Betacoronavirus Lineage C and Identification of N-Terminal Dipeptidyl Peptidase As The Virus Receptor

Zhang et αϊ.2004Προσδιορισμός ενός αντιγονικού προσδιοριστή στον τομέα S2 του σοβαρού οξέος αναπνευστικού συνδρόμου γλυκοπρωτεΐνη αιχμής του κορονοϊού ικανή να προκαλέσει εξουδετερωτικά αντισώματα

Tan και συν.2004Μια νέα πρωτεΐνη κορονοϊού με σοβαρό οξύ αναπνευστικό σύνδρομο, U274, μεταφέρεται στην κυτταρική επιφάνεια και υφίσταται ενδοκυττάρωση

VandenHoogen et al.2004Αντιγονική και γενετική μεταβλητότητα ανθρώπινων μεταπνευμοϊών

JP4644486B22011-03-02Η πρωτεΐνη, η πολυμεράση και η αιμοσυγκολλητίνη / εστεράση αυξάνουν τον κορωνοϊό αναπνευστικού κορωνοϊού (CRCV)

Pecora et al.2014Πρώτο εύρημα γενετικής και αντιγονικής ποικιλομορφίας σε απομονωμένα 1b-BVDV από την Αργεντινή

Leifer et al.2009Ο τροποποιημένος υποψήφιος εμβολιασμός ζωντανών δεικτών CP7_E2alf παρέχει έγκαιρη έναρξη προστασίας από θανατηφόρα πρόκληση μόλυνσης με ιό κλασικής πανώλους των χοίρων μετά από ενδομυϊκή και στοματική ανοσοποίηση

Ο Han και συν.2004Ανάπτυξη μιας δοκιμασίας ασφαλούς εξουδετέρωσης για τον SARS-CoV και χαρακτηρισμός της S-γλυκοπρωτεΐνης

Abd Allah et al.2020Η νανοϊατρική ως μια πολλά υποσχόμενη προσέγγιση για τη διάγνωση, τη θεραπεία και την προφύλαξη από τον COVID-19

Lu et al.2004Ανοσολογικός χαρακτηρισμός της πρωτεΐνης αιχμής του σοβαρού οξέος αναπνευστικού συνδρόμου κορονοϊού

JP2007511237A2007-05-10Νέος άτυπος ιός πνευμονίας

Ni et αϊ.2007Οι ανασυνδυασμένοι αλφαϊοί είναι ασφαλή και χρήσιμα ορολογικά διαγνωστικά εργαλεία

Leifer et al.2012Χαρακτηρισμός παραλλαγών διαφυγής TAV-επιτόπου C-στέλεχος «Riems» που λαμβάνονται μέσω επιλεκτικής πίεσης αντισωμάτων στην κυτταρική καλλιέργεια

Duckmanton et al.1998Τοροϊός βοοειδών: αλληλουχία των δομικών γονιδίων και έκφραση της νουκλεοκαψιδικής πρωτεΐνης του ιού Breda

Wang et αϊ.2020Παθογένεια και ανοσογονικότητα ενός νέου στελέχους επιδημικής διάρροιας χοίρου που περιέχει νέα διαγραφή στο γονίδιο Ν

JP2019506850A2019-03-14Εμβόλιο δείκτη λοιμώξεων

US20070116716A12007-05-24Πρωτεΐνες του κορονοϊού Sars και χρήσεις αυτών

Bitew et αϊ.2013Καταρροϊκός πυρετός: Πρωτεΐνες ιών και πρόσφατες διαγνωστικές προσεγγίσεις

JP2013514813A2013-05-02Νέα σύνθεση πνευμονοϊού και τρόπος χρήσης

ΚΟΥΛΚΑΡΝΗ2017ΕΦΑΡΜΟΓΗ ΤΟΥ MATRIX (M) ΣΤΗ FUSION (F) ΜΗ ΚΩΔΙΚΟΠΟΙΗΤΙΚΗ ΠΕΡΙΟΧΗ ΓΙΑ ΤΗ ΓΕΝΟΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΙΝΔΙΚΩΝ ΙΔΡΩΝ ΙΟΛΟΓΩΝ ΙΟΥ

Πνεύμα2013Ανάπτυξη διαγνωστικών μεθόδων και εξέταση αστοχιών εμβολιασμού για τον ιό της μολυσματικής βρογχίτιδας από κορωνοϊό των πτηνών

Κόλγκαν2014Ορολογική και ιολογική έρευνα σχετικά με τον επιπολασμό εντερικών και αναπνευστικών κορωνοϊών στον ουγγρικό και αυστριακό πληθυσμό σκύλων

KR101345787B12013-12-27Νέος ιός γρίπης των χοίρων Α H1N1 και χρήση αυτού

Ραφαήλ2015Διερεύνηση της απόδοσης των συσκευών πλευρικής ροής στη διάγνωση και τον γενετικό χαρακτηρισμό του ιού του αφθώδους πυρετού στην Τανζανία

Προτεραιότητα και σχετικές εφαρμογές

Εφαρμογές γονέων (1)

ΕφαρμογήΗμερομηνία προτεραιότηταςΗμερομηνία κατάθεσηςΣχέσηΤίτλος

US10 / 822.9042003-04-252004-04-12ΔιαίρεσηΚορωνοϊός απομονωμένος από ανθρώπους

Αιτήσεις προτεραιότητας (3)

ΕφαρμογήΗμερομηνία προτεραιότηταςΗμερομηνία κατάθεσηςΤίτλος

US46592703P2003-04-252003-04-25Προσωρινή εφαρμογή των ΗΠΑ

US10 / 822.9042003-04-252004-04-12Κορωνοϊός απομονωμένος από ανθρώπους

US11/748,3592003-04-252007-05-14Κορωνοϊός απομονωμένος από ανθρώπους

Εφαρμογές που διεκδικούν προτεραιότητα (1)

ΕφαρμογήΗμερομηνία κατάθεσηςΤίτλος

US11/748,3592007-05-14Κορωνοϊός απομονωμένος από ανθρώπους

Νομικά γεγονότα

ΗμερομηνίαΚώδικαςΤίτλοςΠεριγραφή

2007-06-28ΟΠΩΣ ΚΑΙΑΝΑΘΕΣΗ ΕΡΓΑΣΙΑΣ

Όνομα ιδιοκτήτη : Η ΚΥΒΕΡΝΗΣΗ ΤΩΝ ΗΝΩΜΕΝΩΝ ΚΡΑΤΩΝ ΤΗΣ ΑΜΕΡΙΚΗΣ Α

Κείμενο ελεύθερης μορφής : ΑΝΑΘΕΣΗ ΣΥΜΦΕΡΟΝΤΩΝ ΣΥΜΜΕΤΟΧΩΝ; ΕΠΙΧΕΙΡΗΜΑΤΕΣ: ANDERSON, LARRY J.; BELLINI, WILLIAM J.

2014-02-17FPAYΠληρωμή τέλους

Έτος πληρωμής τέλους : 4

2018-04-02FEPPΔιαδικασία πληρωμής τελών

Δωρεάν μορφή κειμένου : ΤΕΛΗ ΣΥΝΤΗΡΗΣΗΣ ΤΗΛΕΟΠΟΙΗΣΗ ΤΑΧΥΤΗΤΑ (ΚΩΔΙΚΟΣ ΠΡΩΤΟΤΗΤΑΣ ΕΚΔΗΛΩΣΗΣ: REM.)

2018-09-24ΠΑΙΔΙΑΛάθος για μη πληρωμή τελών συντήρησης

Κείμενο δωρεάν μορφής : Η ΠΑΤΕΝ έχει λήξει για αποτυχία πληρωμής τελών συντήρησης (ΚΩΔΙΚΟΣ ΠΡΩΤΟΤΗΤΑΣ ΕΚΔΗΛΩΣΗΣ: ΛΗΞΗ). ΚΑΤΑΣΤΑΣΗ ΟΝΤΟΤΗΤΑΣ ΙΔΙΟΚΤΗΤΗ ΔΙΕΥΘΥΝΣΗΣ: ΜΕΓΑΛΗ ΟΝΤΕΟΤΗΤΑ

2018-09-24STCHΠληροφορίες σχετικά με την κατάσταση: διακοπή διπλώματος ευρεσιτεχνίας

Κείμενο ελεύθερης μορφής : Η ΠΑΤΕΝΤΑ ΛΗΞΕ ΛΟΓΩ ΜΗ ΠΛΗΡΩΜΗΣ ΤΕΛΩΝ ΣΥΝΤΗΡΗΣΗΣ ΥΠΟ 37 CFR 1,362

2018-10-16FPΈληξε λόγω μη πληρωμής τέλους συντήρησης

Ημερομηνία έναρξης ισχύος : 20180817

Έννοιες

εκχυλισμένο από μηχανή

 ΚατεβάστεΠίνακας φίλτρων

ΟνομαΕικόναΤμήματαμετρώΑντιστοίχιση ερωτήματος

 Αλφακοροϊόςτίτλος10.000

 νουκλεϊκά οξέααξιώσεις, περίληψη, περιγραφή1690.000

 σοβαρό οξύ αναπνευστικό σύνδρομοαξιώσεις, περίληψη, περιγραφή580.000

 Σοβαρό οξύ αναπνευστικό σύνδρομοαξιώσεις, περίληψη, περιγραφή90.000

 coronaviridaeαξιώσεις, περιγραφή860.000

 μέθοδος ενίσχυσης νουκλεϊκού οξέοςαξιώσεις, περιγραφή440.000

 ενίσχυσηαξιώσεις, περιγραφή420.000

 αλυσιδωτή αντίδραση πολυμεράσηςαξιώσεις, περιγραφή230.000

 προϊόντααξιώσεις, περιγραφή220.000

 βαφέςαξιώσεις, περιγραφή170.000

 Πολυμεράση Taqαξιώσεις, περιγραφή40.000

 μείγματαπερίληψη, περιγραφή560.000

 Αλληλουχία νουκλεϊκών οξέωνπερίληψη, περιγραφή420.000

 ομάδα αμινοξέων άλφαπερίληψη, περιγραφή290.000

 διεγερτικόςπερίληψη, περιγραφή280.000

 άγνωστος ανθρώπινος κορωνοϊόςπερίληψη, περιγραφή120.000

 ασθένειες από μολυσματικούς παράγοντεςπερίληψη, περιγραφή100.000

 αιτιολογικός παράγοντας της νόσουπερίληψη, περιγραφή20.000

 Κορονοϊό SARSαφηρημένη40.000

Εμφάνιση όλων των εννοιών από την ενότητα περιγραφή

Δεδομένα που παρέχονται από τις υπηρεσίες διπλωμάτων ευρεσιτεχνίας IFI CLAIMS

https://patents.google.com/patent/US7776521B1